PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:21466 Links D10S2175 Homo sapiens chromosome 10, locus KIAA1128 Macaca mulatta chromosome 9, locus KIAA1128 Pan troglodytes chromosome 10, locus KIAA1128 Sus scrofa chromosome 14, locus LOC100156899 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Sus scrofa. Primer Information Forward primer: ATTTCAAAGGACTCATAGCTCCC Reverse primer: GTTTGAACTCTCTCCATCTGATAGC PCR product size: 110-111 (bp), Homo sapiens GenBank Accession: G06928 T40448    Homo sapiens Name: D10S2175 Also known as: EST91252 G00-677-902 GDB:677902 WI-8523 Polymorphism info:   Cross References Gene GeneID: 54462   Symbol: KIAA1128   Description: KIAA1128   Position: 10q23.1 UniGene Hs.461988 KIAA1128 Mapping Information D10S2175 Sequence Map: Chr 10|HuRef Map Viewer   Position: 79978881-79978991 (bp)   D10S2175 Sequence Map: Chr 10|Celera Map Viewer   Position: 80128389-80128499 (bp)   D10S2175 Sequence Map: Chr 10 Map Viewer   Position: 86123431-86123541 (bp)   WI-8523 Whitehead-RH Map: Chr 10 Map Viewer   Position: 501.3 (cR3000)   Lod score: P1.16   WI-8523 GeneMap99-GB4 Map: Chr 10 Map Viewer   Position: 410.72 (cR3000)   Lod score: 0.00   Reference Interval: D10S1786-D10S541   WI-8523 Whitehead-YAC Map: Chr 10 Map Viewer   Reference Interval: WC10.7 Electronic PCR results RefSeq mRNA (1) NM_018999.2 1688 .. 1798 (111 bp)     mRNA (4) AB032954.1 756 .. 866 (111 bp)   AK024324.1 1477 .. 1587 (111 bp)   AF241785.1 1242 .. 1352 (111 bp)   BC030528.1 1651 .. 1761 (111 bp)     Genomic (8) G06928.1 198 .. 308 (111 bp)   AC074321.10 100190 .. 100300 (111 bp)   CH003457.1 79498675 .. 79498785 (111 bp)   CH003505.1 83597768 .. 83597878 (111 bp)   CH471142.2 5018149 .. 5018259 (111 bp)   CM000261.1 80128389 .. 80128499 (111 bp)   DS486155.1 228113 .. 228223 (111 bp)   CM000471.1 79978881 .. 79978991 (111 bp)     ESTs (8 of 12)[Show All Hits] T40448.1 198 .. 308 (111 bp)   AW027699.1 213 .. 323 (111 bp)   BE766949.1 227 .. 337 (111 bp)   BQ050928.1 438 .. 548 (111 bp)   CB143190.1 85 .. 195 (111 bp)   CD579783.2 421 .. 533 (113 bp)   BP361497.1 370 .. 480 (111 bp)   CR991891.1 406 .. 516 (111 bp)     Whole Genome Shotgun sequences (4) AADD01109391.1 6908 .. 7018 (111 bp)   AADC01092676.1 6909 .. 7019 (111 bp)   AADB02013228.1 857119 .. 857229 (111 bp)   ABBA01003755.1 222391 .. 222501 (111 bp)        Macaca mulatta Name: D10S2175 Polymorphism info:   Cross References Gene GeneID: 698006   Symbol: KIAA1128   Description: KIAA1128   Position:   UniGene Mmu.17046 Similar to granule cell antiserum positive 14 Mapping Information D10S2175 Sequence Map: Chr 9 Map Viewer   Position: 52916491-52916601 (bp)    Pan troglodytes Name: D10S2175 Polymorphism info:   Cross References Gene GeneID: 450566   Symbol: KIAA1128   Description: KIAA1128   Position:   Mapping Information D10S2175 Sequence Map: Chr 10 Map Viewer   Position: 84485668-84485778 (bp) Electronic PCR results RefSeq mRNA (3) XM_001155270.1 1688 .. 1798 (111 bp)   XM_001155519.1 1482 .. 1592 (111 bp)   XM_507884.2 1482 .. 1592 (111 bp)     Genomic (1) CM000324.1 84485668 .. 84485778 (111 bp)     ESTs (1) DC525085.1 336 .. 446 (111 bp)     Whole Genome Shotgun sequences (2) AADA01226676.1 17195 .. 17305 (111 bp)   AACZ02115779.1 18389 .. 18499 (111 bp)        Sus scrofa Name: D10S2175 Polymorphism info:   Cross References Gene GeneID: 100156899   Symbol: LOC100156899   Description: similar to Protein GCAP14 homolog   Position:   Mapping Information D10S2175 Sequence Map: Chr 14 Map Viewer   Position: 81934188-81934298 (bp) Electronic PCR results Working Draft phase 1 (from GenBank HTGS division) (1) CU468056.2 82351 .. 82461 (111 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) CU607038.2 159282 .. 159392 (111 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement