PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:576 Links D3S3658 Primer Information Forward primer: AAAAGTTAGCAAACACAATCCTATC Reverse primer: CTGGACTAAATCTAAGTTGGTTATG PCR product size: 104-126 (bp), Homo sapiens GenBank Accession: Z53657    Homo sapiens Name: D3S3658 Also known as: AFMb330ze5 B330ZE5 GDB:611196 HSB330ZE5 SHGC-21606 W6688 Polymorphism info: on genetic map Cross References Gene GeneID: 7400   Symbol: USH2B   Description: Usher syndrome 2B (autosomal recessive, mild)   Position: 3p24.2-p23 Mapping Information D3S3658 Sequence Map: Chr 3|Celera Map Viewer   Position: 40841645-40841758 (bp)   D3S3658 Sequence Map: Chr 3 Map Viewer   Position: 40878262-40878375 (bp)   D3S3658 Sequence Map: Chr 3|HuRef Map Viewer   Position: 40948041-40948154 (bp)   D3S3658 deCODE Map: Chr 3 Map Viewer   Position: 64.98 (cM)   AFMb330ze5 Genethon Map: Chr 3 Map Viewer   Position: 60.00 (cM)   AFMb330ze5 Marshfield Map: Chr 3 Map Viewer   Position: 65.26 (cM)   SHGC-21606 TNG Map: Chr 3 Map Viewer   Position: 25073 (cR50000)   Lod score: 0.1   Reference Interval: 65   AFMb330ze5 GeneMap99-G3 Map: Chr 3 Map Viewer   Position: 1702 (cR10000)   Lod score: F   Reference Interval: D3S1260-D3S3582   D3S3658 Whitehead-YAC Map: Chr 3 Map Viewer   Reference Interval: WC3.6 Electronic PCR results Genomic (5 of 8)[Show All Hits] Z53657.1 25 .. 138 (114 bp)   AC099541.2 112338 .. 112451 (114 bp)   CH003450.1 41058089 .. 41058202 (114 bp)   CH003498.1 47090347 .. 47090460 (114 bp)   CH471055.1 40841645 .. 40841758 (114 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC068861.2 76895 .. 77008 (114 bp)   CT009548.2 208446 .. 208559 (114 bp)     Whole Genome Shotgun sequences (5) AADD01032085.1 3998 .. 4111 (114 bp)   AADC01028424.1 93721 .. 93834 (114 bp)   AADB02314567.1 248 .. 371 (124 bp)   AADB02003455.1 246988 .. 247101 (114 bp)   ABBA01024789.1 384038 .. 384151 (114 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement