refSNP ID: rs1054613 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 86/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/C Ancestral Allele: A Clinical Association: unknown HGVS Names NM_080610.1:c.*26A>C NT_011387.8:g.23485559T>G Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss1532686 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs1054613 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss1532686 LEE|585376 fwd/T A/C actgagtgaaacccactcacaggcttgtcc tgtgctgctcccacattccgtggacatcag 09/13/00 10/10/03 86 cDNA unknown ss4396434 LEE|ge585376 fwd/T A/C actgagtgaaacccactcacaggcttgtcc tgtgctgctcccacattccgtggacatcag 04/25/02 10/10/03 106 cDNA unknown ss4421696 LEE|e585376 fwd/T A/C actgagtgaaacccactcacaggcttgtcc tgtgctgctcccacattccgtggacatcag 04/26/02 10/10/03 106 cDNA unknown ss75175733 ILLUMINA|ILMN_Human_1M_rs1054613 fwd/T A/C actgagtgaaacccactcacaggcttgtcc tgtgctgctcccacattccgtggacatcag 08/28/07 08/29/07 129 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs1054613|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/C'|mol=cDNA|build=129 GACCTGCTTG GAGGGATTCC ACTGAGTGAA ACCCACTCAC AGGCTTGTCC M TGTGCTGCTC CCACATTCCG TGGACATCAG CACTACTCTC CTGAGGACTC   GeneView GeneView via analysis of contig annotation: CST9L cystatin 9-like View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_011387->NM_080610 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_011387->NM_080610-> 23485559 reverse 712 3' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs1054613 maps exactly once on NCBI human chromosome 20 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 20 NT_011387.8 23485559 23493559 minus T ref_assembly reference reference view 50 20 NW_001838653.1 1091289 23506860 minus T alt_assembly_8 HuRef HuRef view 50 20 NW_927317.1 23476001 23618825 minus T alt_assembly_1 Celera Celera view 50   NCBI Resource Links Submitter-Referenced GenBank AA911102 Hs.121554 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank HTGS Finished: GenBank mRNA: NM_080610.1 AL121894.26 AY358615.1 BC029656.1 UniGene Cluster ID 121554   Population Diversity Sample Ascertainment Genotypes Alleles ss# Population Individual Group Chrom. Sample Cnt. Source HWP A C ss1532686 CEPH 184 AF 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0 0 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .