PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:446811 Links stSG607267 Bos taurus chromosome 1, locus SON Canis familiaris chromosome 31, locus SON Equus caballus chromosome 26, locus LOC100052256 Homo sapiens chromosome 21, locus SON Macaca mulatta chromosome 3, locus SON Pan troglodytes chromosome 21, locus SON Found by e-PCR in sequences from Bos taurus, Canis familiaris, Homo sapiens, Ovis aries and Pan troglodytes. Primer Information Forward primer: GCAATTTGCCCTCAGAGGTA Reverse primer: ACTGTCAAATGAGAAGCTGCG PCR product size: 186 (bp), Homo sapiens    Bos taurus Name: stSG607267 Polymorphism info:   Cross References Gene GeneID: 516462   Symbol: SON   Description: SON DNA binding protein   Position:   Mapping Information stSG607267 Sequence Map: Chr 1 Map Viewer   Position: 1058735-1058919 (bp) Electronic PCR results Genomic (2) AJ780930.1 43251 .. 43435 (185 bp)   CM000177.3 1058735 .. 1058919 (185 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC150508.5 146541 .. 146725 (185 bp)     Working Draft phase 2 (from GenBank HTGS division) (2) AC139312.2 48622 .. 48806 (185 bp)   AC139732.2 135241 .. 135425 (185 bp)     Whole Genome Shotgun sequences (1) AAFC03026657.1 146541 .. 146725 (185 bp)        Canis familiaris Name: stSG607267 Polymorphism info:   Cross References Gene GeneID: 478406   Symbol: SON   Description: SON DNA binding protein   Position:   Mapping Information stSG607267 Sequence Map: Chr 31 Map Viewer   Position: 31199205-31199396 (bp) Electronic PCR results RefSeq mRNA (1) XM_851635.1 6703 .. 6894 (192 bp)     Genomic (2) CM000031.2 31199205 .. 31199396 (192 bp)   AC186686.9 153540 .. 153731 (192 bp)     Working Draft phase 2 (from GenBank HTGS division) (2) AC120521.2 31387 .. 31578 (192 bp)   AC119067.4 156196 .. 156387 (192 bp)     Whole Genome Shotgun sequences (1) AAEX02031853.1 83632 .. 83823 (192 bp)        Equus caballus Name: stSG607267 Polymorphism info:   Cross References Gene GeneID: 100052256   Symbol: LOC100052256   Description: similar to SON DNA binding protein, isoform f (predicted)   Position:   Mapping Information stSG607267 Sequence Map: Chr 26 Map Viewer   Position: 30217574-30217757 (bp)    Homo sapiens Name: stSG607267 Polymorphism info:   Cross References Gene GeneID: 6651   Symbol: SON   Description: SON DNA binding protein   Position: 21q22.1-q22.2|21q22.11 UniGene Hs.517262 SON DNA binding protein Mapping Information stSG607267 Sequence Map: Chr 21|Celera Map Viewer   Position: 20131699-20131884 (bp)   stSG607267 Sequence Map: Chr 21|HuRef Map Viewer   Position: 20410530-20410715 (bp)   stSG607267 Sequence Map: Chr 21 Map Viewer   Position: 33853935-33854120 (bp) Electronic PCR results Genomic (5 of 13)[Show All Hits] AP000046.1 81563 .. 81748 (186 bp)   AP000114.1 87539 .. 87724 (186 bp)   AP000190.1 87539 .. 87724 (186 bp)   AP000304.1 123 .. 308 (186 bp)   AP001717.1 168713 .. 168898 (186 bp)     ESTs (5 of 7)[Show All Hits] R91414.1 159 .. 344 (186 bp)   H58726.1 149 .. 337 (189 bp)   H78868.1 75 .. 261 (187 bp)   N65952.1 171 .. 357 (187 bp)   BI032185.1 52 .. 237 (186 bp)     Whole Genome Shotgun sequences (4) AADD01172327.1 12670 .. 12855 (186 bp)   AADC01142629.1 83741 .. 83926 (186 bp)   AADB02020342.1 5351791 .. 5351976 (186 bp)   ABBA01057351.1 29646 .. 29831 (186 bp)        Macaca mulatta Name: stSG607267 Polymorphism info:   Cross References Gene GeneID: 704712   Symbol: SON   Description: similar to SON DNA-binding protein isoform A   Position:   Mapping Information stSG607267 Sequence Map: Chr 3 Map Viewer   Position: 13001361-13001546 (bp)    Oryctolagus cuniculus   Polymorphism info:   Cross References UniGene Ocu.638 Transcribed locus, strongly similar to XP_221656.3 PREDICTED: similar to Son...    Ovis aries   Polymorphism info:   Cross References UniGene Oar.11002 Transcribed locus, strongly similar to NP_064357.1 Son cell proliferation pr... Electronic PCR results ESTs (1) EE763641.1 441 .. 625 (185 bp)        Pan troglodytes Name: stSG607267 Polymorphism info:   Cross References Gene GeneID: 473971   Symbol: SON   Description: SON DNA binding protein   Position:   Mapping Information stSG607267 Sequence Map: Chr 21 Map Viewer   Position: 33307702-33307887 (bp) Electronic PCR results RefSeq mRNA (2) XM_001165709.1 7174 .. 7359 (186 bp)   XM_001165659.1 7384 .. 7569 (186 bp)     Genomic (4) BS000154.1 139205 .. 139390 (186 bp)   BS000181.1 79288 .. 79473 (186 bp)   BA000046.3 19667702 .. 19667887 (186 bp)   AC186391.2 66024 .. 66209 (186 bp)     Whole Genome Shotgun sequences (1) AADA01245253.1 10598 .. 10783 (186 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement