ITEMS FROM THE RUSSIAN FEDERATION

SIBERIAN INSTITUTE OF PLANT PHYSIOLOGY AND BIOCHEMISTRY

Siberian Division of the Russian Academy of Sciences, Lermontov str., 132, Irkutsk-33, P.O Box 1243, Russian Federation, 664033.

Productivity of spring wheat as a function of soil temperature and nitrogen fertilizer. [p. 123-125]

A.K. Glyanko, N.V. Mironova, and G.G. Vasilieva.

Introduction. The economic performance of agronomic plants is reflected genetically in their potential productivity, which is attained in the specific climatic and agrotechnological conditions of the region. As a rule, the production potential of crop plants is much higher than real productivity because of the influence of various abiotic and biotic factors of the external environment. The forms of N fertilizers are external factors, capable of changing the metabolism of plants because of the different modes of assimilation (Glyanko 1995; Lips 1997). In turn, N fertilizers help plants react to the adverse environments, such as low and high temperature extremes. Temperature and nitrogen, thus, are involved in attaining the potential productivity of spring wheat. We made an investigation on the influence of low (7-9 C) and high (25-30 C) soil temperatures and N- fertilizer forms (nitrate, ammonia, and urea) on spring wheat productivity.

Material and methods. The experiments were with the spring wheat cultivar Scala, cultivated in the Irkutsk area of the Russian Federation (East Siberia). Plants were grown in enameled containers containing 5 kg of air-dried soil. We used sandy soil with an insignificant level of total nitrogen (0.009 %) provided by Gelrigel medium (Grodzinsky and Grodzinsky 1973) and other nitrogen sources such as Ca(NO3)2, (NH4)SO4, and CO(NH2)2. The nutrition medium was counterbalanced with Ca and S, adding equivalent amounts CaSO4 and CaCO3 to the soil. To prevent nitrification in the soil, (NH4)2SO4 and CO(NH2)2 were added along with an inhibitor of nitrification 3,5-dichlormethilpiridin (N-serve) at a level of 1.5 % of soil nitrogen. An analysis of soil in the process of nitrification has indicated that under the influence of N-serve in the soil with N-NH+4, nitrification was noticeably hindered at optimum temperatures within 30 days. Low termperatures also had no effect on the roots. Hydrolysis of urea in the soil did not stop nitrification inhibition, but decreased at low soil temperatures.

During the summer (June September), plants were grown in a growth chamber, five plants/container. One set of plants was grown at a soil temperature of 7-9 C (low), another at 18-22 C (control), and a third at 25-30 C (elevated). Air temperature in the chamber was not adjusted. Afternoon temperatures were within the limits of 20-27 C; night temperatures were 10-14 C. Light exposure in the chamber was defined by natural illumination through a glass covering.

At low soil temperatures, one set of plants was grown to the 4-leaf stage (20 days after germination), the other until the beginning of milk-ripe phase (45 days). Elevated soil temperatures were given for 40 days. At the end of the experiment, the plants were transferred to conditions of the control (18-22 C) and allowed to mature. Harvest was made at full grain maturity (humidity of grain 18-20 %). The grain and above-ground parts of the plants were air dried and weighed. The biological reproducibility was ten-fold. Results are represented as the arithmetic mean with a standard error. The confidence level of the differences was evaluated by the Student's t-test. Least significant difference for comparing treatment means was at P = 0. 95 level.

Results. Influence of low soil temperature (LST) on wheat productivity. The influence of LTS up to the four-leaf stage did not impact grain or straw yield by any of the forms of nitrogen fertilizer (Table 1). In variants with reduced forms of nitrogen, a tendency for decreased grain and straw yield was observed in some cases, but the distinctions were inconclusive. The influence of LST causing a decrease of the total crop (grain + straw) was observed when plants received nutrition by N-NO-3 and urea (16 and 12 %, respectively; significant at P > 0.95). In the N-NH+4 variant, the decrease in total crop yield is doubtful.

The greatest negative impact on LST was on the straw, which decreased 20, 16, and 14 % when nitrate, ammonium, and amide were the nitrogen source, respectively (significant at P > 0.95). Nitrate and urea N sources may cause a decrease in grain yield under LST, but the results of these experiments are doubtful. Long exposure to LTS did not produce any impact on grain yield in plants with a N-NO-3 nutrition source. The greatest negative influence of long-term exposure to LST was in the straw yield; grain yield was effected to a lesser degree. Total plant productivity under LST for 45 days was unchanged with N-NH+4 and decreased by approximately 20 % with nitrate and urea nutrition.

Influence of elevated soil temperature (EST) on wheat productivity. Normally, plants are not tested for EST in Eastern Siberia, although physiologically and in comparison with LST it is of interest. Wheat plants do react to EST (Table 1). In plants with nitrate as a source of N nutrition, grain yield tends to decrease, but straw yield increases. Elevated soil temperatures did not produce any impact on the total productivity of plants with a nitrate source of nitrogen.

Elevated soil temperatures did produce a negative impact on wheat productivity when the source of N nutrition was N-NH+4. This N source decreased grain yield by 9 % (not statistically significant) and straw by 15 % (significant at P > 0.95). Total productivity was lower compared to the control by 12 % (significant at P > 0.95). Surprisingly, the strong negative influence of EST on wheat productivity was exhibited with nutrition by urea. Total productivity in this case decreased by 35 % and grain and straw yields by 45 and 32 %, respectively (significant at P > 0.98 (grain yield) and P < 0.99 (straw yield)).

The impact of temperature on the structure of the main spike and 1,000-kernel weight. The long-term action of LST influenced the spike structure of the main stalk; the number of spikes, flowers, and grains was reduced under N-NO-3 nutrition by 13, 15, and 25 %, respectively. With N-NH+4 and urea sources of nutrition, the influence was less noticeable; the number of flowers (N-NH+4) and grains (urea) was reduced. Short-term exposure to LST produced a significant negative impact on the spike structure. The impact of EST on spike structure is similar to that of LST; the number of spikes, flowers, and grains with all forms of nitrogen fertilizer is reduced.

The long-term influence of LST on plants using all forms of nitrogen is an increase in 1,000-kernel weight compared with the control (132, 132, and 113 % with nitrate, ammonium, and amide sources of nitrogen, respectively). The short-term action of LST has no measured influence on 1,000-kernel weight. Enhanced soil temperature increases 1,000-kernel weight with nitrate (133 %) and ammonia (113 %) but is reduced with urea (13 %).

Influence of temperature on length vegetative period of wheat. Low soil temperatures lengthen the vegetative period of wheat for 6-8 days on a short-term exposure and for 25-30 days after a long-term exposure to extreme temperatures. To the contraty, EST reduces the vegetative period of wheat 3-6 days.

Conclusions. The adverse effects of temperature on plant productivity depend on the form of N fertilizer. With N-NO-3 nutrition, EST negatively effects grain yield and positively effects straw yield. The negative influence of EST with reduced forms of nitrogen is greatest when urea is used as a nutrition source. With long-term exposure to LST, the negative action is better shown with nutrition of an oxidizing form of nitrogen. The short-term influence LST does not give a reliable negative influence on wheat productivity of wheat, which is explained by an increase in vegetative productivity of the plants especially with an N-NO-3 nutrition source.

References.

• Glyanko AK. 1995. Nitrogen nutrition of wheat at low temperatures. Nauka, Novosibirsk (In Russian).
• Grodzinsky AM and Grodzinsky DM. 1973. Concise manual on plant physiology. Kiev (In Russian).
  Lips SH. 1997. The role of nitrogen ions in plant adaptation processes. Rus J Plant Physiol 44:421-431 (In Russian).
  

Pore permeability in the mitochondria of winter wheat. [p. 125-128]

O.I. Grabelnych, N.S. Pavlovskaya, T.P. Pobezhimova, A.V. Kolesnichenko, O.N. Sumina, and V.K. Voinikov.

The participation of mitochondria in the process of programmed cell death has been reported. The main features of this process are the disruption of mitochondrial membranes, the increase of Ca+2 concentration in the mitochondria, permeability transition pore (PTP) opening, and the release of cytochrome c- and apoptosis-inducing factors (Jones 2000; Ferri and Kroemer 2001). Ca+2 ions are the most important factor for opening the PTP (Zoratti and Szabo 1995), which can be reverted by addition of different chelating agents. The opening of the PTP is inhibited by low pH, adenine nucleotides, protons, divalent cations, free-radical scavengers, polyamines, and cyclosporin A (CsA) (Zoratti and Szabo 1995; Bernardi 1996). Inhibition of PTP opening by CsA was demonstrated and shown to be mediated by binding to a family of intracellular receptors such as cyclophilins (Nicolli et al. 1996).

We know that PTP opening depends on a mitochondria-oxidizing substrate. In particular, skeletal muscle mitochondria had an increased probability of PTP opening when electron flux increases through complex I and, therefore, Fontaine and Bernardi (1999) proposed that complex I may be part of the pore complex. On the other hand, Huang et al. (2001) showed that in liver mitochondria, PTP opening is more sensitive and responsive with FADH-linked succinate.

The presence of CsA-sensitive PTP in plant mitochondria was suggested by Vianello et al. (1995) and recently was shown in potato tuber mitochondria (Arpagaus et al. 2002). At the same time, a cyclosporin A-insensitive permeability transition has been described in potato tubers and oat mitochondria (Fortes et al. 2001; Curtis and Wolpert 2002).

Because CsA is used as a diagnostic tool for the characterization of PTP in isolated mitochondria, the aim of this investigation was the influence of cyclosporin A on cold-resistant winter wheat mitochondria function and the relationships between different complexes of electron transport chain function and PTP opening.

Materials and Methods. Three-day-old, etiolated shoots of the winter wheat cultivar Zalarinka were germinated on moist paper at 26 C. The mitochondria were isolated from seedling shoots by differential centrifugation (Pobezhimova et al. 2001), and their energetic activity was studied. The isolated mitochondria were resuspended in a medium including 40 mM MOPS-KOH buffer (pH 7.4), 300 mM sucrose, 10 mM KCl, and 1 mM MgCl2, with and without 5 mM EDTA. Mitochondria activity was recorded polarographically at 26 C using a closed-type platinum electrode in a 1.4 ml cell volume. The reaction mixture contained 125 mM KCl, 18 mM KH2PO4 (pH 7.4), 1 mM MgCl2, with and without 5 mM EDTA. Oxidation substrates were 10 mM malate in the presence of 10 mM glutamate, 8 mM succinate in the presence of 5 mM glutamate, and 1 mM NADH. During succinate and NADH oxidation, 3 mkM rotenone was added to the incubation medium. The concentration of cyclosporin A was 1 mkM, and the Ca+2 concentration of was 200 mkM. The concentration of mitochondrial protein was analyzed according to Lowry et al. (1951). Polarograms were used to calculate the rates of phosphorylative respiration (state 3), nonphosphorylative respiration (state 4), respiratory control by Chance-Williams, and the ADP:O ratio (Estabrook 1967). All the experiments were performed on 3-6 separate mitochondrial preparations.

Results and Discussion. Mitochondria are known to be one of the main sources of reactive oxygen species in the plant cell. This process can be controlled by an increase in noncoupled (Vanlerberghe and McIntosh 1997) and uncoupled (Sluse and Jarmuszkiewicz 2002) respiration. One can assume that cold resistance in winter cereals may depend on the transition of mitochondria into a state of low energy. On the other hand, PTP opening in plant mitochondria can participate in apoptotic processes.

In our work, we studied the influence of CsA on oxidation of different mitochondrial respiratory chain substrates when electrons are transferring through complexes I, II, and III. Because EDTA is a well-known chelating agent that can eliminate cations from the reaction medium, it was necessary to study the influence of CsA on mitochondrial energetic activity in the presence and absence of EDTA in all reaction media used. The influence of CsA was performed in state-4 mitochondria, because the coupling action of CsA in such mitochondria can show the existence of PTPs in plant mitochondria. The influence of the addition of CsA on mitochondrial energetic parameters was shown as a percent of state-4 respiration.

We found that at the presence of EDTA in all media with CsA added did not significant influence the state-4 respiration in mitochondria, oxidizing all substrates studied (< 9 % decrease). Because Ca+2 ions regulate PTP opening, we studied the influence of these ions and CsA on the function of winter wheat mitochondria in the absence of EDTA in all reaction media. We found that incubation of mitochondria with Ca+2 caused significant changes in their energetic activity. In malate-oxidizing mitochondria, Ca+2 addition caused a 46 % increase in state-4 respiration, a 48 % decrease in the RC coefficient, and an 18 % decrease in the ADP:O ratio (Table 2). In succinate-oxidizing mitochondria, this treatment caused a 19 % increase in state-4 respiration, a 28 % decrease in the RC coefficient, and a 21 % decrease of ADP:O ratio (Table 2). In NADH-oxidizing mitochondria, we detected a 22 % increase in state-4 respiration and a 33 % decrease in the RC coefficient, but we did not observed changes in the ADP:O ratio (Table 2). Such changes in mitochondrial energetic activity shows uncoupling of oxidative phosphorylating and can cause PTP opening.

The absence of EDTA in the incubation media for winter wheat mitochondria, CsA addition caused a decrease in oxygen consumption in malate-, succinate-, and NADH-oxidizing mitochondria. The most significant changes were detected in mitochondria incubated with the addition of Ca+2. If in the absence of Ca+2, CsA addition caused a 25 % decrease in state-4 respiration in malate-oxidizing mitochondria, a 12 % decrease in state-4 respiration in succinate-oxidizing mitochondria, and a 31 % decrease in state-4 respiration in NADH-oxidizing mitochondria, then in the presence of Ca+2 this treatment caused a 62 % decrease in state-4 respiration in malate-oxidizing mitochondria, a 20 % decrease in state 4 respiration in succinate-oxidizing mitochondria, and a 47 % decrease in state-4 respiration in NADH-oxidizing mitochondria (Fig. 1). We can see that the most pronounced effect of CsA addition in the absence of exogenous Ca+2 was detected in NADH-oxidizing mitochondria. At the same time, in the presence of Ca+2 in incubation medium, the most pronounced effect of CsA addition was detected in malate-oxidizing mitochondria. In succinate-oxidizing mitochondria, CsA addition caused less changes.

Therefore, our data show that CsA caused a decrease in state-4 respiration in winter wheat mitochondria. The most pronounced effect of this treatment was detected in mitochondria in the presence of Ca+2 ions. The influence of CsA addition is substrate-specific. Unlike animal mitochondria, the main influence of CsA in the absence of Ca+2 ions was detected in NADH-oxidizing mitochondria in our experiments. In our opinion, the presence of a number of rotenone-insensitive, NADH-dehydrogenases in plant mitochondria (Moller 2001) can participate in PTP formation together with complex I.

Acknowledgements. The work has been performed, in part, with the support of the Russian Science Support Foundation, Russian Foundation of Basic Research (project 03-04-48151) and the Siberian Division of Russian Academy of Sciences Youth Grant (project 78).

References.

• Arpagaus S, Rawyler A, and Braendle R. 2002. Occurrence and characteristics of the mitochondrial permeability transition in plants. J Biol Chem 277:1780-1787.
• Bernardi P. 1996. The permeability transition pore. Control points of a cyclosporine A-sensitive mitochondrial channel involved in cell death. Biochim Biophys Acta 1275:5-9.
• Curtis MJ and Wolpert TJ. 2002. The oat mitochondrial permeability transition and its implication in victorin binding and induced cell death. Plant J 29:295-312.
• Estabrook RW. 1967. Mitochondrial respiratory control and the polarographic measurement of ADP:O ratio. Methods Enzymol 10:41-47.
• Ferri KF and Kroemer G. 2001. Organelle-specific initiation of cell death pathways. Nature Cell Biol 3:255-263.
• Fontaine E and Bernardi P. 1999. Progress on the mitochondrial permeability transition pore: regulation by complex I and ubiquinone analogs. J Bioenerg Biomembr 31:335-345.
• Fortes F, Castilho RF, Catisti R, Carnieri EGS, and Vercesi AE. 2001. Ca2+ induces a cyclosporin A-insensitive permeability transition pore in isolated potato tuber mitochondria mediated by reactive oxygen species. J Bioenerg Biomembr 33:43-51.
• Huang X, Zhai D, and Huang Y. 2001. Dependence of permeability transition pore opening and cytochrome C release from mitochondria on mitochondria energetic status. Mol Cell Biochem 224:1-7.
• Jones A. 2000. Does the plant mitochondrion integrate cellular stress and regulate programmed cell death. Trends Plant Sci 5:225-230.
• Lowry OH, Rosebrough NJ, Farr AL, and Randall RJ. 1951. Protein measurement with Folin phenol reagent. J Biol Chem 193:265-275.
• Moller IM. 2001. Plant mitochondria and oxidative stress: electron transport, NADH turnover, and metabolism of reactive oxygen species. Ann Rev Plant Mol Biol 52:561-591.
• Nicolli A, Basso E, Petronilli V, Wenger RM, and Bernardi P. 1996. Interactions of cyclophilin with the mitochondrial inner membrane and regulation of the permeability transition pore, a cyclosporine A-sensitive channel. J Biol Chem 271:2185-2192.
• Pobezhimova TP, Grabelnykh OI, Kolesnichenko AV, Sumina ON, Voinikov VK. 2001. Localization of proteins immunologically related to subunits of stress 310-kD protein in winter wheat mitochondria. Rus J Plant Physiol 48:204-209.
• Sluse FE and Jarmuszkiewicz W. 2002. Uncoupling proteins outside the animal and plant kingdoms: functional and evolutionary aspects. FEBS Lett 510:117-120.
• Vanlerberghe GC and McIntosh L. 1997. Alternative oxidase: from gene to function. Ann Rev Plant Physiol Plant Mol Biol 48:703-734.
• Vianello A, Macri F, Braidot E, and Mokhova EN. 1995. Effect of cyclosporin A on energy coupling in pea stem mitochondria. FEBS Lett 371:258-260.
• Zoratti M and Szabo I. 1995. The mitochondrial permeability transition. Biochim Biophys Acta 1241:139-176.

The influence of monounsaturated fatty acids on the function of winter wheat mitochondria. [p. 128-131]

O.I. Grabelnych, N.Yu. Pivovarova, T.P. Pobezhimova, A.V. Kolesnichenko, O.N. Sumina, and V.K. Voinikov.

Free fatty acids (FFA) are well-known as effective uncouplers of oxidative phosphorylation. Fatty acid-induced uncoupling occurs by different pathways: a calcium-dependent, cyclosporin A-sensitive pathway, associated with permeability transition pore (PTP) opening (Wieckowski and Wojtczak 1998; Wieckowski et al. 2000); uncoupling by interaction with some specific mitochondrial innermembrane proteins such as ADP/ATP antiporter and UCP-like proteins (Jezek 1999; Skulachev 1999); and uncoupling by function of fatty acids as low-effective protonophores (Wojtczak and Schonfeld 1993; Skulachev 1998). Free fatty acid-dependent uncoupling is inhibited by the addition of bovine serum albumin (BSA), purine nucleotides, and carboxyatractyloside, which is a specific inhibitor of ADP/ATP antiporter (Skulachev 1991). This free fatty acid-dependent uncoupling of oxidative phosphorylation functions as a cold-protective adaptation mechanism especially for lowering the content of reactive oxygen species in mitochondria (Casolo et al. 2000; Pastore et al. 2000).

Previously, cold shock was shown to cause about a twofold increase in FFA content in cereal seedling shoots (Vojnikov et al. 1983). At that time, the main FFA were unsaturated fatty acids with C16-20. In those experiments, the FFA content increased, and the uncoupling of oxidative phosphorylation in mitochondria during cold stress depended on activation of phospholipase A2 (Vojnikov et al. 1983). Ruelland et al. (2002), using Arabidopsis cell cultures, showed an increase of phospholipase C and D activity after cold treatment.

In our previous work (Grabelnych et al. 2003), we showed that linoleic acid (LA) (18:2 n-9,12) in concentrations higher than 10 mkM can not only cause uncoupling of oxidative phosphorylation in winter wheat mitochondria but that mitochondria can use this FFA as a very effective oxidation substrate. Linoleic acid concentrations higher than 50 mkM mitochondria change their metabolism to using LA as an oxidation substrate, because the rate of LA-supported respiration becomes equal to the uncoupled rate after the addition of LA respiration during malate oxidation. The LA-dependent increase in oxygen consumption is involved with the functioning of all branches of mitochondrial electron transport chain, both phosphorylative and nonphosphorylative (Grabelnych et al. 2003). At the same time, we do not know if isolated mitochondria can use other FFA that exist in plants and whose contents are increased under cold shock as oxidation substrates. The aim of this investigation was the study of possibility of a number of FFAs to be an oxidative substrate for winter wheat mitochondria.

Materials and Methods. Three-day-old etiolated shoots of the winter wheat cultivar Zalarinka were germinated on moist paper at 26 C. Mitochondria were extracted from seedling shoots by differential centrifugation (Pobezhimova et al. 2001). The isolated mitochondria were resuspended in 40 mM MOPS-KOH buffer (pH 7.4), 300 mM sucrose, 10 mM KCl, 5 mM EDTA, and 1 mM MgCl2. Mitochondrial activity was recorded polarographically at 27°C using a closed-type, platinum electrode in a 1.4-ml cell (Estabrook 1967). The reaction mixture contained 125 mM KCl, 18 mM KH2PO4, 1 mM MgCl2, and 5 mM EDTA, pH 7.4. Malate (10 mM) in the presence of glutamate (10 mM) was used as oxidation substrates. The concentrations of used monounsaturated fatty acid (erucic (22:1 n-9), oleic (18:1 n-9), and its isomer petroselinic (18:1 n-12), were 0.056 mkM-10 mM. In the first set of experiments, we added different amounts of FFAs to malate-oxidizing mitochondria in state 4. In the second set of experiments, we added different amounts of FFAs to mitochondria in a polarograph cell without adding another oxidation substrate. Polarograms were used to calculate the rates of phosphorylative respiration (state 3), nonphosphorylative respiration (state 4), respiration controlled by Chance-Williams (RC), and the ADP:O ratio (Estabrook 1967). The concentration of mitochondrial protein was analyzed according to Lowry et al. (1951). All the experiments were performed on three separate mitochondrial preparations. The data obtained were analyzed statistically and arithmetic means and standard errors determined.

Results and Discussion. The amount of total FFA in winter wheat mitochondria is about 15 ng/mg of mitochondrial protein (0.056 mkM) and increases to ~40 ng/mg (0.15 mkM) after short-term cold shock (Vojnikov et al. 1983). In our experiments, we used physiological concentrations of FFA and higher concentrations (1 mkM-10 mM). We studied uncoupling activity and the possibility of an oxidative substrate of monounsaturated FFA that exist in plants, oleic acid, petrozelinic acid, and erucic acid.

We found that in addition to state-4 mitochondria, physiological and even higher (up to 5 mkM) concentrations of oleic acid (18:1 n-9) did not cause any changes in the rate of oxygen consumption (Fig. 2A, 1). Concentrations higher than 5 mkM caused an increase of oxygen consumption with a maximum (65 % increase as compared with the variant without oleic acid) at 30 mkM of oleic acid added (Fig. 2A, 1). Further increasing the oleic acid concentration (to 70 mkM) caused a less significant increase in oxygen consumption than when 30 mkM added. A very high concentration of oleic acid added to state-4 mitochondria (from 100 mkM up to 5 mM) did not influence on oxygen consumption (Fig. 2A, 1). The study of a possibility of winter wheat mitochondria use oleic acid as an oxidation substrate showed that all concentration of this FFA added to mitochondria did not caused any oxygen consumption by mitochondria (Fig. 2A, 2).

Studying the uncoupling activity of the oleic acid isomer petroselinic acid (18:1 n-12) showed that added concentrations up to 100 mkM did not influence mitochondrial energetic activity (Fig. 2B, 1). Concentrations from 500 mkM to 2 mM caused an increase in oxygen consumption with a maximum at 1 mM (3.4-fold increase) (Fig. 2B, 1). Concentrations higher than 5 mM did not influence mitochondrial oxygen consumption. Assuming that mitochondria may use petroselinic acid as an oxidation substrate was positive (Fig. 2B, 2). The maximum petroselinic acid oxidation-dependent oxygen consumption was detected at the same concentration as for FFA added when the maximum uncoupling effect was detected, 1 mM (Fig. 2B, 1, 2). At this concentration, we detected an even higher oxygen consumption than for state-4 malate-oxidizing mitochondria.

The uncoupling activity of erucic acid (22:1 n-9) showed a slight (but not statistically significant) increase in mitochondrial oxygen consumption even when physiological concentrations were added (Fig. 2C, 1). A statistically significant increase in uncoupled respiration was detected only when concentrations higher than 100 mkM of erucic acid were added to state-4 mitochondria. The maximum increase of oxygen consumption (about 63 %) was detected when 1 mM of FFA was added. Further increases in FFA concentration caused a decrease of its uncoupling effect (Fig. 2C, 1). Studying the possibility of mitochondria to use erucic acid as an oxidation substrate showed that winter wheat mitochondria can oxidize this FFA at concentrations between 100 mkM and 1 mM of FFA added. The most pronounced effect was detected at concentration 100 mkM. Further increases in the concentration of FFA added did not cause a significant increase of oxygen consumption. Therefore, erucic acid can be oxidized by winter wheat mitochondria.

As shown previously, linoleic acid can be oxidized very effectively by winter wheat mitochondria at concentrations of FFA added higher than 50 mkM but its uncoupling effect was detected at concentrations higher than 10 mkM (Grabelnych et al. 2003). It is interesting to note that uncoupling effect of oleic acid was very similar to its of linoleic acid but they are different in their possibility to be an oxidation substrate - if mitochondria can very effectively oxidize linoleic acid they cannot oxidize oleic acid. On the other hand, petroselinic and erucic acids were similar in their uncoupling action and in their possibility to be an oxidation substrate.

Based on the data from present and previous work, we can divide all FFA studied into two variants: 1. FFA that can only uncouple oxidative phosphorylation but can not be used as oxidation substrate by mitochondria and 2. FFA that can both uncouple oxidative phosphorylation and be used as oxidation substrate by mitochondria (Table 3). In this case, exogenous FFA are translocated into mitochondria through inner membranes cause cotransport of protons and, therefore, uncoupling of oxidative phosphorylation. Later, they do not move by assistance of a UCP protein into the mitochondrial intramembrane space according to the FFA-cycling mechanism hypothesis (Jezek et al. 1997) but enter the cycle of FFA b-oxidation and become oxidation substrates. Thus, unsaturated free fatty acids in winter wheat mitochondria can not only play the role of uncouplers, but also can be the only oxidation substrate for them.

Acknowledgments. The work was made possible, in part, with the support of the Russian Science Support Foundation, Russian Foundation of Basic Research (project 03-04-48151) and Siberian Division of Russian Academy of Sciences Youth Grant (project 78).

References.

• Casolo V, Bradiot E, Chiandussi E, Macri F, Vianello A. 2000. The role of mild uncoupling and non-coupled respiration in the regulation of hydrogen peroxide generation by plant mitochondria. FEBS Lett 474:53-57.
• Estabrook RW. 1967. Mitochondrial respiratory control and the polarographic measurement of ADP:O ratio. Methods Enzymol 10:41-47.
• Grabelnych OI, Funderat SP, Pobezhimova TP, Kolesnichenko AV, and Voinikov VK. 2003. The function of different mitochondrial respiratory-chain pathways in winter wheat mitochondria during short-term cold stress and hardening. Ann Wheat Newslet 49:108-110.
• Jezek P. 1999. Fatty acid interaction with mitochondrial uncoupling proteins. J Bioenerg Biomembr 31:457-466.
• Jezek P, Costa ADT, and Vercesi AE. 1997. Reconstituted plant uncoupling mitochondrial protein allows for proton translocation via fatty acid cycling mechanism. J Biol Chem 272:24272-24278.
• Lowry OH, Rosebrough NJ, Farr AL, and Randall RJ. 1951. Protein measurement with folin phenol reagent. J Biol Chem 193:265-275.
• Pastore D, Fratianni A, Di Pede S, and Passarella S. 2000. Effects of fatty acids, nucleotides and reactive oxygen species on durum wheat mitochondria. FEBS Lett 470:88-92.
• Pobezhimova TP, Grabelnykh OI, Kolesnichenko AV, Sumina ON, and Voinikov VK. 2001. Localization of proteins immunologically related to subunits of stress 310-kD protein in winter wheat mitochondria. Russ J Plant Physiol 48:204-209.
• Ruelland E, Cantrel C, Gawer M, Kader J-C, and Zachowski A. 2002. Activation of phospholipases C and D is an early response to a cold exposure in Arabidopsis suspension cells. Plant Physiol 130:999-1007.
• Skulachev VP. 1991. Fatty acid circuit as a physiological mechanism of uncoupling of oxidative phosphorylation. FEBS Lett Vol 294:158-162.
• Skulachev VP. 1998. Uncoupling: new approaches to an old problem of bioenergetics. Biochim Biophys Acta 1363:100-124.
• Skulachev VP. 1999. Anion carriers in fatty acid-mediated physiological uncoupling. J Bioenerg Biomembr 31:431-445.
• Vojnikov VK, Luzova GB, and Korzun AM. 1983. The composition of free fatty acids and mitochondrial activity in seedlings of winter cereals under cold shock. Planta 158:194-198.
• Wiekowski MR and Wojtczak L. 1998. Fatty acid-induced uncoupling of oxidative phosphorylation is partly due to opening of the mitochondrial permeability transition pore. FEBS Lett 423:339-342.
• Wiekowski MR, Brdiczka D, and Wojtczak L. 2000. Long-chain fatty acid promote opening of the reconstituted mitochondrial permeability transition pore. FEBS Lett 484:61-64.
• Wojtczak L and Schonfeld P. 1993. Effect of fatty acid on energy coupling processes in mitochondria. Biochim Biophys Acta 1183:41-57.
  

Cold resistance in spring wheat as a function of nitrogen form. [p. 131-135]

A.K. Glyanko, N.V. Mironova, and G.G. Vasilieva.

Introduction. Cold resistance implies a plants ability to grow at suboptimal temperatures (Drozdov et al. 1984; Korovin 1984; Rodchenko et al. 1988). S pring wheat is a cold-resistant plant, so low positive temperatures within hardening range, even acting for a long time, do not bring about lethal outcome although they certainly produce a negative impact on the productivity (Korovin 1984; Glyanko et al. 2004). The cold resistance of different plant varieties of moderate climates is genetically predetermined. However, most of these plants possess minimal resistance at low temperatures and other factors optimal for growth and development. Maximum resistance in these plants indicates some unfavorable factors, for example, at hardening temperatures (Glyanko 1995). This idea is in agreement with the hypothesis of Drozdov et al. (1984) regarding the fact that natural temperatures fall into zones within which a plant demonstrates different levels of resistance within the limits genetically conditioned for a certain variety. Thermal hardening of plants by low, positive temperatures increases their resistance to extreme factors (i.e., frosts) in many plants from moderate climates including spring wheat.

Nature may condition plants to intensify their resistance depending on climatic factors. In eastern Siberia, the crop variety phenotype is adjusted for growth in temperatures that sharply change during the day. In these conditions, varieties may demonstrate more intense growth processes compared to southern varieties. Plants of the latter type, grown at low positive temperatures, reduce growth and intensity of metabolism, whereas varieties of Siberian selection in these conditions are less inhibited in growth and metabolism.

Thus, variety specificity of plants with cold resistance at low but not damaging temperatures becomes obvious. Presumably, cold-resistant varieties, with compared with those with less cold resistance, possess a stronger ability for adaptation to temperature, which allows them to reduce vital functions to a lesser extent. Nevertheless, different cultivars will show different abilities to resist cold at damaging (lethal) and nondamaging temperatures. We distinguish between resistance to low, positive nondamaging temperatures and resistance to damaging low temperatures or frosts. In the first case, plants of a resistant variety or hybrid show a more intense metabolism and growth. In the second case, plants are characterized by less intense growth and metabolic processes. The hypothesis on the protective role of a reduction of exchange process intensity in the cells towards damaging factors, which was advanced by Melekhov (1983), is particularly interesting in this light.

Based on this information and results of experiments on the impact of different nitrogen forms on metabolic processes in spring wheat (Glyanko et al. 2002a; Glyanko et al. 2003), we investigated cold resistance of seedlings of the spring wheat cultivar Skala with nutrition by different forms of nitrogen (NO-3 and NH+4).

Material and Methods. Spring wheat plants of the cultivar Skala were grown in growth chambers of the Siberian phytotron (Irkutsk) in enamel containers. Sandy soil with a low total nitrogen concentration (0.009 %) was used as a substrate. A nutrient mixture (Thomas et al. (1978) with various nitrogen sources (Ca(NO3)2, NH4(SO4)2) was used in the soil. Other experimental conditions, without nitrogen and with zeolite saturated with ammonium, also were used. The amount of N-NH+4 adsorbed by zeolite from the NH4(SO4)2 solution were equal to 448 mg/container. Zeolite was used to prevent the possible toxic impact of NH+4 by gradual release of adsorbed nitrogen cation into soil solution (Ando et al. 1988). Upon emergence of sprouts at 20 C, the seedlings were transferred to different temperature conditions for the remainder of the experiment: variant 1, with a 24 hours of low air temperature at 10 C; variant II, 20 C daily air temperature and 10 C night temperatures (control); and variant III, 20 C daily air temperature, 10 C night temperature plus low soil temperature (11 ± 1 C) for 24 hours.

Illumination in the chambers was provided by DRL-700 lamps. Infrared radiation was impeded by a water screen. The photoperiod was 16 day/8 night hours. Wheat seedlings were hardened (acclimated) to low temperature at the 3-leaf phase at a temperature of 10 C day and 5 C night for 5 days with artificial illumination (12 Kl). Control plants were grown at 20 C during the day and 10 C at night.

The linear growth of the plants was determined with auxanographies, which allow monitoring the growth of the topmost leaf during 24 hours (Shevelukha 1977). Protein nitrogen content was determined by the micromethod of Keldal (Ermakov et al. 1987). The tests were repeated 5-10 times. The results are represented as mean ± standard error.

Results and Discussion. Data representing average growth at different stages of plant development (2-, 3-, and 4-leaf stage) showed that the impact of 24-hour low temperatures on the plants results in a more intense inhibition of linear growth of the seedlings supplied with N-NO-3 (by 21 25 %) compared to plants grown on reduced nitrogen (Table 4). The difference is statistically valid at P > 0.99. When compared to variant II (20 C day/10 C night), inhibition amounted to 63 and 49 % for plants grown on nitrate and ammonium nitrogen sources, respectively. Consequently, in comparison with the control, growth inhibition is most pronounced in plants when nitrate nutrition was used.

In the control variant II, the rate of plants growth was approximately the same at all nitrogen sources. However, in variant III, where all the plants were affected not only by low air night temperature but also by low soil temperature, growth decreased by 21 % only in the treatment with nitrate. Difference statistically significant at P > 0.95. Apparently, the difference was due to an intense decrease in plant growth at night when the impact of low air and soil temperatures overlapped. Therefore, wheat seedlings supplied N-NO-3 are more sensitive to low positive temperature, which also is confirmed by data on the accumulation of dry substance by wheat seedlings. The concentration of dry substance decreases under the 24-hour influence of low temperature with a nitrate source of nitrogen (by 37 % compared to the plants absorbing N-NH+4) (Table 5).

This data may be interpreted based on the concept of cold resistance understood as a plants ability not only to survive at low temperature, but to maintain high growth rate and productivity. Consequently, the physiological state of the plants supplied reduced form of mineral nitrogen allows these plants to be more cold resistant (as compared to the plants supplied with N-NO+3). Using nitrate nitrogen for wheat nutrition is likely to ensure better cold hardening of plants. In this case, plants will switch off the implementation of productivity and switch on mechanisms that ensure survival in extreme cold conditions (Glyanko and Vasilieva 2002b). Because linear growth of plants is accepted as a criterion of cold resistance, the role of growth in thermal resistance of the plants needs comment. The role of growth processes in a plants resistance has consensus of opinion. Pollock (1990) reported on the high negative correlation between growth intensity of a number of plants and their resistance to freezing. On the other hand, Rodchenko et al. (1988) found a certain level of growth processes is an indispensable condition for increasing cold resistance of maize root cells. We believe that the different opinions regarding the role of growth in thermal resistance are due to the existence of different resistance types. In our case, this is connected with impact of low positive temperature and frosts on wheat plants. We believe that growth processes have either a positive or a negative connection with resistance depending on the type and degree of the external factor. If resistance is associated with the possibility of growth and development in the current environmental conditions, which being external still allow the plant to grow within its genotypic limits, the cultivar with the more intense growth processes and metabolism should be considered cold resistant. Under the impact of sudden damaging factors, e.g., frost, plants able to minimize vital processes will suffer the least from the destructive influence of the external factor.

Growth and metabolism are interrelated vital processes. Inhibition of growth processes brings about restructuring of metabolism. However, depending on the type of influence on the plant (extreme temperatures, physiologically active substances, or mineral nutrition), the degree of suppression or stimulation of growth processes should be different. At the same time, growth is undoubtedly under genetic control. Growth, as a polygenic feature, may be expressed at reproductive or by an increase in resistance. The former is connected with high growth intensity; the latter with little growth. Both high and low rates of growth processes are likely to be under genetic control, different growth rates of plants absorbing oxidized or reduced forms of nitrogen are most likely conditioned by various metabolic restructuring processes in the cells at unfavorable temperature. The essence of an organism's phenotypic changes is at the posttranslational level (Drozdov et al. 1984). According to Lips (1997), different growth rates in plants absorbing oxidized or reduced forms of nitrogen under external factors is associated with the disturbance of potassium-malate shunt. Our data demonstrate that this may cause a reduction in the amount of water amount available to the cells, a shift of hormonal balance towards accumulation of abscisic acid, and restructuring of protein exchange (Glyanko 1995).

Opinions regarding the role of nitrogen exchange in plant growth processes at low temperature differ (Theodorides and Person 1982; Alekhina and Klyuikova 1986; Tormanova et al. 1991). From our data, plant growth at low positive temperature is connected with intake and assimilation of nitrogen. Affecting growth and metabolism processes they may alter wheat resistance to low environmental temperature at the phenotypic level. The influence of nitrogen as a nutrition source can be seen from the data of Tables 4 and 5, where plant growth on a medium without nitrogen differs from those supplemented with nitrogen. To confirm this fact, we tested hardened spring wheat seedlings with different types of nitrogen nutrition. Taking into account the numerous data on the role of easily soluble proteins in the formation of cold resistance, we used this parameter to assess the resistance of wheat seedlings to low hardening temperatures by different forms of nitrogen nutrition. Our results indicate that cold hardening increases the concentration of both soluble (in 0.1 M Tris-buffer, pH 7.7), and insoluble protein (Table 6). However, differences between nitrate and ammonium nutrition exist. Nitrate cold hardening contributes to an increase in the concentration of easily soluble nitrogen in bottom and top leaves, which is particularly pronounced (by 146 %) in the upper growing leaf. In the middle leaf, the concentration of easily soluble protein does not change. During hardening, nitrate-nourished plants significantly increase the content of insoluble protein in the bottom and top leaves.

In ammonium-nourished plants, cold hardening contributes to the increase of easily soluble protein concentration only in the top leaf (by 123 %) and sharply decreases the concentration of insoluble protein; the latter apparently favors protein destruction.

The ratio between insoluble and soluble proteins in unhardened nitrate-nourished plants increases from the bottom to the top leaf; the situation is reversed in ammonium-nourished plants. Cold hardening in nitrate-nourished plants results in stabilizing this ratio for all the leaves. In ammonium-nourished plants, cold hardening brings about a sharp decrease from the bottom to the top leaf.

Thus, cold hardening changes the direction of protein synthesis in wheat seedlings and, depending on nitrogen form, the character of these changes varies: nitrate nutrition provokes increase of synthesis of both easily soluble and structural proteins, ammoniium nutrition only of soluble proteins. According to Brown and Bixby (1973), the insoluble protein fraction, largely associated with membranes, is responsible for the initial stages of increase in cold tolerance, whereas maximum resistance is associated with the combined action of soluble and insoluble proteins. Temperature hardening is known to lead to synthesis of so-called stress proteins in plants (Voinikov 1989; Thomashov 1999). Our data indicate that some changes in the spectrum of proteins synthesized occur in the course of cold hardening depending on the form of nitrogen used for plant nutrition. Therefore, we favor the idea of an unequal impact of nitrate and ammonium nitrogen on metabolism in spring wheat which, in turn, affects growth processes and resistance of the plants to low temperature.

References.

• Ando H, Adachi K, Minami M, and Nischida N. 1988. Effect of soil ammonium nitrogen on the tillering habit of rice plant. Jap J Crop Sci 57:678-684.
• Brown GN and Bixby IA. 1973. Quantitative and qualitative changes in total protein and soluble proteins during induction of cold hardiness in black locust stem tissue. Cryobiology 10:529-532.
• Drozdov SN, Kurets VK, and Titov F. 1984. Thermal resistance of actively vegetating plants. Nauka, Leningrad (In Russian).
• Ermakov AI, Arasimovich VV, and Yarosh NP. 1987. Methods of biochemical investigation of plants. VO Agropromizdat, Leningrad. pp. 237-238 (In Russia).
• Glyanko AK. 1995. Nitrogen nutrition of wheat at low temperatures. Nauka, Novosibirsk (In Russia).
• Glyanko AK and Vasilieva GG. 2002a. Growth spring wheat as a function of mineral nitrogen and drought. Ann Wheat Newslet 48:126-128.
• Glyanko AK and Vasilieva GG. 2002b. Vital strategies and their role in supporting of the functional stability of spring wheat. Ann Wheat Newslet 48:124-126.
• Glyanko AK, Mironova NV, and Vasilieva GG. 2003. Using urea for the nutrition of spring wheat under adverse temperatures. Ann Wheat Newslet 49:119-124.
• Glyanko AK, Mironova NV, and Vasilieva GG. 2004. Productivity of spring wheat as a function of soil temperature and nitrogen fertilizer. Ann Wheat Newslet 50:123-125.
• Korovin AI. 1984. Role of temperature in mineral nutrition of the plants. Hydrometeoizdat, Leningrad (In Russian).
• Melekhov I. 1983. On possible regulation principle of damage and protective reaction of the cell. J Gen Biol 64:386-397 (In Russian).
• Pollock CJ. 1990. The response of plants to temperature changes. J Agric Sci 115:1-15.
• Rodchenko P, Maricheva E, and Akimova GP. 1988. Adaptation to low temperatures and root growth. Nauka, Novosibirsk (In Russian).
• Shevelukha VS. 1977. Periodicity of agricultural plants growth and ways of its regulation. Urodzhai Publishing House, Minsk (In Russian).
• Thomashov MF. 1999. Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Ann Rev Plant Physiol Plant Mol Biol 50:571-599.
• Thomas RJ, Feller Y, and Erismann KH. 1979. The effect of different inorganic nitrogen sources and plant age on the composition of bleeding sap of Phaseoules vulgaris. New Phytol 82:657-669.
• Tormanova AN, Kenjebaeva CC, and Polimbetova FA. 1991. Interrelation of the nitrous status and growth of plants of winter wheat at acclimation on a background NO3- or NH4+-nutrition. News Acad Sci Kazakh SSR 2:13-21 (In Russian).
• Voinikov V. 1989. Plants stress proteins at low and high temperature. In: Plants stress proteins (Salyaev RK ed). Pp. 5-20. Nauka, Novosibirsk (In Russia).

Transgenic wheat with the gene ugt/iaglu from Zea mays generated by the biolistic technique. [p. 135-137]

R.K. Salyaev, N.V. Pakova, N.I. Rekoslavskaya, and V.M. Sumtzova.

The use of genetic engineering methodology to generate new varieties of agricultural plants with known traits is very desirable. Improvement of crops by the genetic engineering will achieve faster results than other methods of traditional breeding. Agrobacterium-mediated plant transformation is the most often used method for the gene transfer, but Agrobacterium infection is not suitable for monocots and some legumes. Biolistic techniques have been developed in order to transform these recalcitrant plants species. Biolistics is based on force of a powder or gas gun or other commercial devices. Particle bombardment or biolistics has been used to transform a large number of different plant species as well some animals, fungi, and bacteria (Finer et al. 2000).

The ugt/iaglu gene isolated from Z. mays already has been used for the transformation of tomato, potato, aspen, and some other plant species as a target gene that stimulates growth (Rekoslavskaya et al. 1999). UDPG-transferase appears to control the amount of the growth hormone indoleacetic acid in plants (Szerszen et al. 1994). In maize, the pathway to the sugar conjugates of IAA begins with the synthesis of 1-O-b-D-indol-3-ylacetyl-glucose (IAGlu) from uridine 5'-diphosphate-glucose (UDPG) and IAA, catalyzed by the enzyme IAGlu synthetase (UDPG:indol-3-ylacetyl)-b-D-glucosyl transferase, IAA + UDPG = IAGlu + UDP. IAGlu is an acyl alkyl acetal and its energy unfavorable synthesis is followed by an energy favorable transacylation of IAA from IAGlu to myo-inositol in maize. The other gene used in the study was acb isolated from A. thaliana. The ACBP protein participates in the organization of membranes by moving acyl-CoA esters inside cells.

Our goal was to generate transgenic spring wheat plants that express UDPG-transferase encoded by the ugt/iaglu gene from maize. The acb gene was used as an additional target gene. Transformation was done with a gene gun of original design by Salyaev et al. (2001).

Materials and Methods. The spring wheat cultivars Scala and Tulunskaya 12 were used. Immature embryos of 26-30-day-old plants were used as target explants for gene gun transfer of DNA. Morphogenic calli were generated from immature embryos of Scala.

Direct delivery of gene constructions by gene gun. To deliver genetic cassettes to wheat embryos, a gene gun of special design was developed on the basis of a pneumatic gun by shooting microprojectiles. This approach makes it possible to introduce genetic vectors into cells applied on the surface of tungsten microprojectiles of 1.6 u placed on a teflon macroprojectile with a diameter of 4.5 mm. Fresh, isolated immature embryos were used for transformation by performance according to the procedure of Salyaev et al. (2001). After bombardment, transformed and nontransformed embryos were placed on P AGAR with the addition of 0.125 M mannitol and 0.125 M sorbitol. The next day, P AGARs with samples were transferred to an MS medium supplemented with 100 mg/l kanamycin for selection of transgenic shoots. PCR and Southern hybridization were according to standard procedures (Sambrook et al. 1989) described in detail in Rekoslavskaya et al. (2001) and Salyaev et al. (2001).

UDPG-transferase was extracted from plant tissue and purified from the supernatant, and activity determined according to Rekoslavskaya et al. (2001) and Salyaev et al. (2001). The amount of IAA in the plant material was determined with an HPLC according to Rekoslavskaya et al. (2001). The activity of marker enzyme B-glucuronidase (GUS) encoded by the reporter gene gus was determined by standard methods (Jefferson 1987).

Results and Discussion. Direct delivery of gene constructions by gene gun. To study the expression of the selective gene nptII, nontransformed and transformed regenerants obtained from wheat embryos were placed on MS agar with 100 mg/l kanamycin. The effect of 100 mg/l kanamycin on the growth of biolistically transformed spring wheat with genes nptII and ugt is shown in Fig. 3. The growth of wheat plantlets was sharply different: transgenic plants grew faster and taller, nontransformed plants were chlorotic, small, and later became dry.

The expression of the reporter gene gus was studied in transformed and nontransformed embryos by determining the activity of b-glucuronidase with 5-bromo-4-chloro-3-indolyl-b-D-glucuronide (XGlc) as a substrate. Blue spots were observed in the region of apical meristems (Fig. 4) in embryos incubated with XGlc 2-3 days after bombardment. The spots were maintained for 36 days of subculture, indicating the expression of the DNA delivered via particle bombardment into target tissues.

PCR with primers to the ugt gene revealed the homology of DNA from transformed wheat to the ugt gene from corn (Rekoslavskaya et al. 2001; Salyaev et al. 2001). No band of the appropriate size was observed in genomic DNA of nontransformed wheat. Southern hybridization performed on wheat DNA (Salyaev et al. 2001) confirmed the homology of the ugt gene from corn found in genomic DNA of transformed wheat embryos (Fig. 5).

Nontransformed and transgenic plantlets were placed in keramsite growing medium (Fig. 6) and grown until spikes developed. The growth activity of the transgenic wheat was higher in comparison to nontransformed plants (Table 7). The height; leaf and stem number; and leaf, stem, and root mass are all higher in the transgenic plants with the ugt gene (Table 7). The mass of transgenic wheat plants with only the ugt gene was 37.9 g; the mass averaged 45.3 g with both the acb and ugt genes. The mass of one average nontransformed plants was about 2 times less, 20.3 g.

We decided to analyze the auxin status to determine the activity of UDPG-transferase and the IAA content in wheat plants. In transformed wheat there were found the higher specific activity of the target enzyme UDPG-transferase (Table 8) and the increase in IAA content almost in all parts of transgenic wheat in comparison to nontransformed one (Table 9).

Conclusion. We achieved the integration and expression of the gene ugt in plants of spring wheat by means of biolistic methods. The integration of the acb gene was determined with PCR (data not shown). Some positive effects on the growth of transformed wheat plants with both the acb and ugt genes in keramsite beds according to the morphometric analyses were probably because of better adaptability. The good expression of the selective gene nptII and the reporter gene gus were revealed in transgenic wheat of both cultivars of spring wheat. We consider the biolistic method of delivering genes into target tissue was successful. With expression of the ugt gene, a higher activity of UDPG-transferase was determined in transgenic wheat in the cultivar Tulunskaya 12. This activity correlated with the higher contents of IAA almost in all parts of transgenic Tulunskaya 12 wheat. Transgenic wheat plants of both cultivars have an increase in growth in comparison to nontransformed wheat plants, which correlated with the highest auxin status in transgenic wheat plants. Microprojectile bombardment can be used to obtain transgenic wheat the maize ugt gene with the addition of the acb gene from A. thaliana.

References.

• Finer JJ, Finer KR, and Ponappa T. 2000. Particle bombardment mediated transformation. In: Plant Biotechnology, New Products and Applications (Hammond J, McGarvey P, and Yusibov V eds). Springer-Verlag, the Netherlands. Pp. 59-80.
• Jefferson RA, Kavanagh TA, and Bevan MV. 1987. GUS fusion: B-Glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6:3901-3907.
• Rekoslavskaya NI, Zhukova VM, Chekanova EG, Salyaev RK, Mapelli S, and Gamanetz LV. 1999. The auxin status of transformed Solanum plants in the relation with the resistance to 2,4-D and the productivity. Rus J Plant Physiol 46:699-710.
• Rekoslavskaya NI, Salyaev RK, Vysotskaya EF, et al. 2001. Application of target genes and their complexes to plant genetic transformation. In: Genome Studies and Plant Genetic Transformation (Salyaev RK ed). Irkutsk Pp. 83-105.
• Salyaev RK, Rekoslavskaya NI, Sumtsova VM, Pirog OV, and Kuznetsova EV. 2001. Acquisition of transgenic winter wheat via introduction of ugt gene by bioballistic methods. In: Genome Studies and Plant Genetic Transformation (Salyaev RK ed). Irkutsk Pp. 123-131.
• Sambrook J, Fritsch EF, and Maniatis T. 1989. Molecular Cloning, Vols. 1-3. Cold Spring Harbor, New York. 545 p.
• Szerszen JB, Szczyglowski K, and Bandurski RS. 1994. iaglu, a gene from Zea mays involved in conjugation of growth hormone indole-3-acetic acid. Science 265:1699-1701.

Subunits of functional glutenin as structural elements of gluten complex proteins. [p. 137-141]

E.V. Berezovskaya, V.A. Trufanov, T.N. Mitrofanova, and T.A. Pshenichnikova.

Native wheat glutenin is a complex set of biochemically diverse polypeptides connected by different forces of protein-protein interactions. Identifying peculiarities of the genetically determined composition of glutenin functional subfractions is of interest becasue of their immediate participation in the formation of a gluten-protein complex that is responsible for the baking properties of flour.High-molecular glutenin subunits of the majority of industrial wheat cultivars of many countries have been well studied. Important conclusions have been made regarding the participation of these structural elements in the formation of the complicated, multicomponent protein gluten complex responsible for dough and bread quality. Glutenin consists of at least 15-17 subunits with different biochemical natures (molecular mass, amino acid composition, and primary and secondary structure), associated into a single permolecular protein complex via intermolecular, disulfide bonds stabilizing a 3-dimensional, structural gluten matrix. The number of these bonds is a genotypically determined trait with a genetically specific character and determined by the physical properties of gluten and rheological characteristics of the dough (Trufanov 1994).

With the aim of finding favorable alleles, we studied the impact of individual chromosomes of homoeologous groups 1 and 6 that control storage proteins synthesis in wheat lines with intervarietal substitutions based on contrasting baking qualities cultivars on quantitative content of HMW-glutenin subunits in principal functional glutenin subfractions.

Materials and methods. Soft wheat lines with intervarietal substitutions for chromosomes 1A, 1B, 1D, 6A, 6B, and 6D of the cultivar Novosibirskaya 67 (N67), a donor cultivar that is a strong wheat, and the high-protein recipient cultivar Diamant 1 (Dm) with low technological quality were used for the investigation (Obukhova et al. 1997; Maystrenko et al. 1993).

Glutenin subfractions (GN) were obtained from freshly ground flour after removal of albumins, globulins, and gliadins by successive extraction with 0.05 m acetic acid (subfraction GN-1), 4 m urea (subfraction GN-2), and 4 m urea in the presence of 2-mercaptoethanol (subfraction GN-3) (Trufanov 1994). Protein fractions were dialyzed against 0.01 M acetic acid and lyophilized. Subunit composition in the GN-1, GN-2, and GN-3 subfractions was studied after SDS-electrophoresis in a 9 % polyacrylamide gel according to Laemmli (1970). Evaluation of the quantitative content of PAGE zones in the glutenin subfractions of each substituted line was performed by densitometric analysis of electrophoregrams (Fig. 7). The quantitative content of five HMW-glutenin subunits was calculated with the help of a computer program. The results were expressed in relative units and in percent to recipient cultivar Dm.

Results and Discussion. From the data, we concluded that the donor cultivar N67 exceeds the recipient cultivar Dm in relative content groups of glutenin subunits GS 2 and GS 3 in easily soluble fraction of GN-1 glutenin (by 10-12 %), in the sparingly soluble subfraction GN-2 in GS 4 and GS 5 (by 13 and 45 %, respectively), and in the insoluble (without restoration of SS bonds) subfraction GN-3 in GS 1 and GS 2 (by 25 and 10 %, respectively) (Fig. 8). Simultaneously, the donor cultivar N67 is inferior to the recipient Dm in GN-1 content in GS 1 and GS 4 (by 11 and 20 %, respectively), GN-2 content in GS1 and GS3 (by 17 and 7 %, respectively), and GN-3 in GS 3, GS 4, and GS 5 (by 5, 20, and 36 %, respectively).

Obukhova et al. (1997) and Maystrenko et al. (1993) have shown that the subunits 1 and 2 are controlled by chromosomes 1A, 1B, and 1D in Dm and N67, whereas GS 3 contains three components controlled by chromosomes 1B and 1D. One of the components of the GS 3 belonging to N67 is controlled by chromosome 1B, one belongs to the cultivar Dm and also is controlled by 1B, and a third GS 3 component, common for both cultivars, is controlled by chromosome 1D. Several researchers (Obukhova et al. 1997; Maystrenko et al.1993; Payne 1979; Payne 1997) assumed that chromosomes of different homoeologous groups control the compositionally complicated GS 4 and GS 5 (Fig. 9).

Compared to the recipient cultivar Dm, GS 1 content prevails in the GN-1 subfraction in substitution lines of chromosomes 1A, 6A, and 6D, in subfraction GN-2 in the line DS N67 1B (Dm 1B), and in the subfraction GN-3 in lines DS N67 1B (Dm 1B), DS N67 1D (Dm 1D), DS N67 6A (Dm6A), and DS N67 6B (Dm 6B). GS 2 prevails in DS N67 6A (Dm 6A) in subfraction GN-1, in all substituted lines of the subfraction GN-2, and in DS N67 1A (Dm 1A), DS N67 1B (Dm 1B), and DS N67 6A (Dm 6A) in subfraction GN-3.

GS 3 content was higher only in the DS N67 6A (Dm 6A) line in subfraction GN-1 and in the lines DS N67 6B (Dm 6B) and DS N67 6D (Dm 6D). GS 4 content was higher in all the lines of subfractions GN-1 and GN-3. GS 5 only was highest in subfraction GN-1 in substituted lines with chromosomes 1D and 6A and was slightly higher in DS N67 1A (Dm 1A) in subfraction GN-3.

Positive influences of glutenin on subunit content in the recipient cultivar Dm were to various degrees caused by all the chromosomes of the donor cultivar N67. Chromosome 6A caused a considerable effect. The substitution of chromosome 6A resulted in an increased synthesis of all subunits in the soluble subfraction GN-1, two of those in the sparingly soluble subfraction GN-2, and two in the insoluble fraction GN-3. Extraction of the insoluble GN-3 fraction is only possible after complete restoration of inter- and intramolecular SS links that stabilize the gluten structural matrix. Simultaneously, the content of individual glutenin subunits in the substitution lines was lower than in the recipient, particularly that of GS 3, 4, and 5.

Differences in solubility of subfractions GN-1, GN-2, and GN-3 are known to be associated with the density of their spacial structure, which determines the ability of these proteins to form the permolecular protein associates characteristic of gluten (Trufanov 1994). Formation of protein glutenin macroassociations in the grains in vivo happens with the participation of various intermolecular forces, ion-electrostatic interactions, conditioned by acid and base amino acids (AA); hydrophobic contacts (hydrophobic AA); and SS links (cystine). Consequently, the combined impact of nonvalent and covalent forces are determined by the quantity and biochemical properties of individual polypeptides (subunits), primarily by the content and location in polypeptide chains of reactive SH groups that are able to form intermolecular SS bonds. The folding of proteins of various origins and the chaperon-dependent assembling of protein macroassociations in the cell in vivo are known to happen in cotranslation and/or posttranslation periods. Folding and assembling are catalyzed by the system of SH/SS-metabolism enzymes, in particular, by protein disulfide isomerase (Chi-Chen Yong 1998; Marusich 1998; Fisher 1998) responsible for formation, splitting, and isomerization of SS bonds in the proteins. The significant changes observed in the substitution lines in the quantitative content and proportion of HMW-glutenin subunits of functional glutenin fractions of contrasting in the technological properties of wheat cultivars may play an important role in the formation (assembling) and stabilization of functionally important glutenin complexes as a structural basis of gluten.

References.

• Chi-Chen Y. 1998. Isomerase and chaperon activities of protein disulfide isomerase are indispensable for its functioning as foldase. Biochemistry 63(4):484-490.\
• Fisher MT. 1998. Participation of GroE chaperonin in folding and assembling of dodekamer glutaminsythetase. Biochemistry 63(4):453-472.
• Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the bacteriophage. Nature 4(277):680-685.
• Marusich EI, Kurochkina LP, and Mesyanzhinov VV. 1998. Chaperons in the bacteriophage assembling T4. Biochemistry 63(4):473-482.
• Maystrenko OI, Ermakova MF, and Popova RK. 1993. Effects of some chromosome substitution on wheat Triticum aestivum L. technological properties. In: II Russian Symp New Methods in Pant Biotechnology, 18-20 May. Pushino P. 199.
• Obukhova LV, Maystrenko OI, Generalova GV, Ermakova MF, and Popova RK. 1997. Composition of high-molecular weight glutenin subunits in common wheat substitution lines created from cultivars with contrasting bread making qualities. Genetica 33:1179-1184.
• Payne PI, Corfield KG, and Blackman JA. 1979. Identification of a high-molecular-weight subunit of glutenin whose presence correlates with bread-making quality in wheats of related pedigree. Theor Appl Genet 5:153-159.
• Payne PI, Nightingale A, Krattiger AF, and Holt LM. 1997. The relationship between HMW glutenin subunits composition and the bread-making quality of British-grown wheat varieties. J Sci Food Agric 40:51-65.
• Trufanov VA. 1994. Wheat Gluten - Quality problems. Novosibirsk: Nauka. 167 p.

Thiol:protein disulfide oxidoreductase (EC 1.8.4.2) in wheat caryopses. A. Substrate specificity of a homogenous preparation. [p. 141-142]

S.V. Osipova, T.N. Mitrofanova, A.V. Permyakov, and V.A. Trufanov.

According to the actively developed concept of folding, secretory-protein association of wheat storage proteins, their accumulation in protein bodies takes place with the participation of associated endoplasmic reticulum chaperons and enzymes catalyzing formation, isomerization, and dissociation of disulfide bonds (Shewry et al. 1995; Galili et al. 1996; Wang 1998). Indeed, Bulleid and Freedman (1988) demonstrated that the addition of purified protein disulfide isomerase (PDI) to wheat g-gliadins significantly increases the efficiency of disulfide bond formation in these gliadins. Later, Shimoni et al. (1995) extracted PDI from the endosperm of developing wheat caryopses and proved that it was a glycoprotein with a molecular mass of 60 kD localized in the endoplasmic reticulum and protein bodies. Protein disulfide isomerase expression increases during the height of gluten protein synthesis, between 14 and 28 days-after-flowering, when considered along with data on enzyme localization, also supports its necessity for folding and association of wheat storage proteins. Kobrehel et al. (1992) showed that under physiological conditions the system NADFH/thioredoxin h/thioredoxinreductase catalyzes the in vitro cleavage of disulfide bonds of the same wheat proteins. Formation and dissociation of disulfide bonds in wheat storage proteins were presumed to be affected by the balance between activities of enzymes similar to PDI and thioredoxinreductase (Galili et al. 1996).

In our laboratory, we have extracted the enzyme thiol:proteindisulfide oxidoreductase (EC 1.8.4.2) (TPDO) (Trufanov et al. 1999) from the wheat grain. The molecular mass and subunit composition (unpublished results) of the enzyme indicate that it is not PDI, as described by Shimoni et al. (1995) and not thioredoxinreductase (Kobrehel 1992). The enzyme TPDO catalyzes the dissociation of protein disulfides with reduced glutathione as a cofactor. This enzyme is interesting from the point of view of its possible participation, along with PDI and thioredoxinreductase, in the folding of wheat storage proteins and, ultimately, in the formation of wheat technological characteristics. The present work was targeted at the study of substrate specificity of TPDO from the wheat caryopsis.

Materials and Methods. TPDO was extracted after rough grinding flour of Tulunskaya 12, a Siberian wheat selection, and further purified in accordance with the previously described methods (Trufanov et al. 1999). Activity of TPDO was identified by the speed by which SH-group concentration increases in aliquots of reaction mixture selected with certain time intervals at 36 C. Introduced into the incubation medium as substrates were insulin (Endocrine Preparations Factory, Kaunas), BSA (ICN Pharmaceuticals Inc., Costa Mesa, CA, U.S.A.) in different concentrations, and a fraction of gluten proteins soluble in 0.1 M Tris-HCl buffer containing 1 mM EDTA, 10 % sodium salicylate, the purified enzyme (20 mkM ), and the cofactor GSH (1 mM) (Reanal, Hungary). Aliquots were placed in acidulous acetone for protein precipitation. Precipitates were centrifuged at 8,000 X g for 20 min, washed twice with acidulous acetone, and dissolved in 3 ml of 0.1 M Tris-HCl buffer, pH 8.0, containing 1 % Ds-Na. 5, 5'-dithio-bis (2-nitrobenzoic acid) was added to all analytical samples in 0.1 M Tris-HCl buffer, pH 8.0, and after 40 minutes, the optical density was measured at 412 nm. An increase of SH-group concentration/minute (mkmol/min) in the incubation medium was taken for the activity unit. Specific activity was expressed in activity units (E)/mg of enzyme protein, where E = DSH/t. Protein concentration was determined according to Lowry et al. (1951). The control did not contain enzyme. The Mikhaelis constant was determined according to Lainuiver-Berk (Dixon and Webb 1982).

To produce gluten protein preparations, finely ground flour was degreased three times in succession by sulfuric and petroleum ether in the proportion 1:3 (w:v) flour:extracting agent and dried. Gluten was first washed with a 0.01 M solution of sodium pyrophosphate Na, pH 7.0, and then with water. Raw gluten was homogenized in 0.1 M acetic acid and lyophilized. Dry gluten powder was dissolved in 0.1 M Tris11-buffer, pH 7.5, containing 5 mM EDTA and 10% Na salicylate and used in the tests.

Results and Discussion. The kinetic curves of the speed of SS-bond cleavage reaction catalyzed by TPDO as a function of substrate concentration (A-insulin, B-BSA) are shown in Fig. 10. With a 1 mM GSH concentration in the incubation medium, the Km calculated according to Lineweaver-Burk for reciprocals of insulin amounted to 2.18 mkM, which is 5-10 times less than Km values for the analogous enzyme extracted from various animal tissues (Schomburg et al. 1994). The Km for BSA under the same conditions amounted to 570 mkM, which indicates that TPDO has the highest affinity constant to insulin. Data on the dependence of SS-bond dissociation speed on substrate concentration for gluten proteins due to low solubility of these proteins in normal buffers is difficult to obtain. Fig. 11 shows the change of SH-group content over time in an incubation medium containing gluten proteins and 1 mM GSH (Fig. 11, 1), gluten proteins and 1 mM GSH, and TPDO (Fig. 11, 2). If the SH-group content in the incubation medium increases by only 7 % (Fig. 11, 1), the SH-group content increases by almost 40 % with the addition of the TDO enzyme (Fig. 11, 2). Thus, TPDO is able to catalyze dissociation of SS bonds of wheat gluten proteins and apparently participates in the formation of the SH/SS status of wheat reserve proteins.

References.

• Bulleid NJ and Feedman RB. 1988. Defective co-translational formation of disulphide bonds in protein disulfide-isomerase-deficient microsomes. Nature 335:649-651.
• Dixon M and Webb E. 1982. Enzymes. Moskva, Mir.
• Galili G, Shimoni J, Gionini-Silfen Sh, Levanony H, Altschuler J, and Shani N. 1996. Wheat storage proteins: assembly, transport and deposition in protein bodies (a review). Plant Physiol Biochem 34:245-252.
• Shewry PR, Sayanova O, Tatham AS, Tamas L, Turner M, Richard G, Hickman D, Fido R, Halford NG, Greenfild J, Grimwade B, Thomson N, Miles M, Freedman R, and Napier J. 1995. Structure, assembly and targeting of wheat storage proteins. J Plant Physiol 145:620-625.
• Shimoni J, Jhu-Xiao-Jhu L, Segal G, and Galili G. 1995. Purification, characterization and intracellular localization of glycosylated protein disulfide isomerase from wheat grains. Plant Physiol 108:327-335.
• Shomburg D, Salzmann M, and Stephan D (eds). 1994. Enzyme Handbook. Springer-Verlag, the Netherlands.
• Trufanov VA, Kichatinova SV, and Permyakov AV. 1999. Enzymes of the thiol-disulfide exchange in wheat and their effect on gluten proteins. Prikl Biochem Microbiol 35:219-222.
• Wang CC. 1998. Isomerase and chaperone activities of protein disulfide isomerase both are required for its function as a foldase. Biokimiya 63:483-490.

Thiol:proteindisulfide oxidoreductase (EC 1.8.4.2) purified from wheat caryopses. B. Enzymatic characteristics. [p. 143-144]

S.V. Osipova, A.V. Permyakov, T.N. Mitrofanova, and V.A. Trufanov.

The enzyme thiol:proteindisuldife oxidoreductase (TPDO, EC 1.8.4.2) catalyzing the dissociation of SS-bonds of insulin, bovine serum albumin, and proteins of acetic acid-soluble gluten fraction (Trufanov et al. 1999; Osipova et al., previous article) was extracted from mature wheat grain and purified to electrophoretic homogeneity. The physiological role of this enzyme is assumed to be participation in posttranslational modification of cystine-containing gluten proteins and formation of a gluten macromolecular protein complex. We were interested in studying some enzymatic characteristics of proteindisulfide reductase, the impact of inhibitors on TPDO activity, and comparing the identified characteristics with the properties of identical enzymes of animal origin.

Materials and methods. Proteindisulfide reductase activity was determined as described in the previous article (Osipova et al. 2004). Bovine serum albumin (BSA, ICN Pharmaceuticals Inc., Costa Mesa, CA, U.S.A.) was used as a substrate in the incubation medium at a concentration of 40 mg/ml. Inhibitors included 1 mM phenylmethylsulfonylfluoride (PMSF; Calbiochem, Germany), 0.5 and 1 mM N-ethylmaleimide (NEM; Sigma Chemical, St. Louis, MO, U.S.A.), 0.5 and 1 mM p-chloromercuribenzoate (PCMB; Sigma Chemical, St. Louis, MO, U.S.A.), and 0.5 and 1 mM solutions ZnSO4·7H2O and CuSO4·5H2O (Reakhim, Russian Federation). The enzyme was preincubated with inhibitors for 30 minutes at 30 C. Standard methods then were used to determine remaining activity of proteindisulfide reductase. Inhibition percentage was calculated. Dependence of disulfide reductase activity on pH was determined in 0.1 M Tris-HCI buffer + 1 mM EDTA solutions, with pH ranges 5-8 at constant temperature of 36 C. GSH was used as a cofactor at a concentration of 1 mM. Dependence of enzyme activity on temperature was determined in 0.1 M Tris-HCl buffer, pH 7.5, + 1 mM EDTA within a temperature range of 25-46 C.

Results and Discussion. The dependence of disulfide reductase activity on temperature is shown in Fig. 12A. The optimal activity temperature values are 33-38 C; maximum activity was observed at 36 C. Enzymes extracted from animal tissues have approximately the same temperature optimum, 37°C (Varandani et al. 1973; Chandler et al. 1975). Fig. 12B shows that wheat disulfide reductase has an optimum pH between 6.5-7.5, with maximum activity at pH 7.0. At extreme pH values (5.0 and 8.0), about 20 % of maximum activity of disulfide reductase is preserved. The optimum pH values for the wheat enzyme are similar to the optimum for animal disulfide reductase (Ansorge et al. 1973; Tomizawa et al. 1962), only some researchers identify more alkaline optimum pH values, 7.5-8.5 (Chandler et al. 1975; Carmichael et al. 1979). Therefore, with respect to optimum pH and temperature activity, wheat disulfide reductase is similar to the analogous enzymes extracted from animals.

Inhibition tests. Specific reagents for the SH group (Table 9) were used for inhibitor analysis. Bivalent ions of copper and zinc linking SH-groups forming mercaptans demonstrate 100 % inhibition of disulfide reductase activity. Alkalizing agents, NEM and PCMB also inhibit SS-reductase activity, with NEM being a stronger suppressor, which might be explained by different accessibility of enzyme active center SH-groups for these compounds. We presume from these data that thiol:proteindisulfide oxidoreductase in the wheat caryopsis is a representative of thioredoxin superfamily with a thioredoxin-like domain -Cys-Cly-His-Cys- in the active center (Darby and Greiton 1995). The inhibitor PMSF, a serine protease, also suppresses disulfide reductase activity quite significantly, by 50 %. The serine hydroxyl group also is likely to be important for disulfide reductase activity. Thus, the enzyme extracted from the wheat caryopsis is similar to animal proteindisulfide reductases by some characteristics (pH and optimum temperature) as well as by inhibition by alkalizing agents and heavy metals ions.

References.

• Ansorge S, Bohley P, Kirschke H, Langner J, Wiederanders B, and Hanson H. 1973. Metabolism of insulin and glucagons glutetion-insulin transhydrogenase from microsomes of rat liver. Eur J Biochem 32:27-35.
• Carmichael DF, Keefe M, Pace M, and Dixon JE. 1979. Interchangeable forms of thiol:protein disulfide oxidoreductase. J Biol Chem 254:8386-8390.
• Chandler ML and Varandani PT. 1975. Kinetic analysis of the mechanism of insulin degradation by glutathione-insulin transhydrogenase (thiol:protein-disulfide oxidoreductase). Biochemistry 14:2107-2115.
• Darby NJ and Greighton TE. 1995. Characterization of the active site cysteine residues of the thioredoxin-like domain of protein disulfide isomerase. Biochemistry 34:16770-16780.
• Osipova SV, Mitrofanova TN, Permyakov AV, and Trufanov VA. 2004. Thiol:proteindisulfide oxidoreductase (EC 1.8.4.2) wheat caryopses. A. Substrate specificity of a homogeneous preparation. Ann Wheat Newslet 50:141-142.
• Tomizawa HH. 1962. Properties of glutathione insulin transhydrogenase from beef liver. J Biol Chem 237:3393-3396.
• Trufanov VA, Kichatinova SV, and Permyakov AV. 1999. Prikl Biochim Microbiol 35:219-222.
• Varandani PT. 1973. Insulin degradation. V. Unmasking of glutathione-insulin transhydrogenase in rat liver microsomal membrane. Biochim Biophys Acta 304:642-659.

Thiol:proteindisulfide oxidoreductase (EC 1.8.4.2) wheat caryopses. C. Impact on aggregation of wheat storage proteins. [p. 144-145]

S.V. Osipova, A.V. Permyakov, T.N. Mitrofanova, and V.A. Trufanov.

The ability of wheat storage proteins to aggregate is one of important parameters characterizing the rheological properties of dough and gluten quality (Arakava and Yonezawa 1975; Arakava et al. 1976). The enzyme thiol:proteindisulfide oxidoreductase, isolated from the wheat caryopsis, its substrate specificity, and some enzymatic properties were described in previous articles (pp. 141-144), catalyzes the dissociation of disulfide bonds in gluten proteins. We are interested in the impact of this enzyme on the aggregation properties of the acetic acid-soluble fraction of wheat storage proteins.

Materials and Methods. To determine aggregation, we used the acetic acid-soluble gluten fraction of wheat cultivar Tulunskaya 12 extracted by standard methods. Gluten from preliminarily degreased flour was first washed by 0.1 M solution of sodium pyrophosphate, pH 7.0, and then with water. Raw gluten was dissolved in 0.1 M acetic acid and lyophilized. Aggregation parameters were determined according to the method of Arakawa and Yonezawa (1975). In the control, equal volumes of a gluten-protein solution in 0.1 M acetic acid (final protein concentration 0.01 %) and 0.2 M sodium phosphate buffer, pH 5.6, containing 0.5 M NaCl and 1 mM GSH cofactor were mixed. Thiol:proteindisulfide oxidoreductase (3-5 activity units) was added during the test. The optical density of the solution was measured by spectrophotometry (350 nm) according to the aggregation process time. The following formula was used to calculate aggregation (t10/C, solution turbidity per protein concentration unit for 10 minutes of the processing): t10 = 2D/C, where D is the optical density of the solution at l = 350 nm and C is the % protein concentration. The results were analyzed by common statistical methods.

Results and Discussion. The results of the test on the impact of thiol:proteindisulfide oxidoreductase on aggregating ability of gluten acetic acid -soluble fraction are shown (Fig. 13). Because wheat disulfidereductase is a glutathione-dependent enzyme, GSH (1 mM) was used in both the control and test substances during the course of the experiment. A test at pH 5.6 recommended by the standard methods (Fig. 13A). The aggregating ability of the protein is reduced after introduction of the enzyme as compared to the control. The aggregation parameter t10/C decreased in the test when compared to control, from 134.1± 4.6 (control) to 114.6 ± 1.2 (test), a 15-22 % decrease. Furthermore, during the 25 minutes of the experiment (until aggregation was terminated), the aggregation parameter in the control was 143.6 ± 5.1 and in the test sample was 119.4 ± 1.2. The test was conducted at pH 7.5, which is optimal for disulfidreductase activity (Fig. 13B). In this case, the aggregation parameter t10/ C decreased by 25-30 % with the addition of the enzyme. The reduction in aggregation parameters is apparently due to the dissociation of S-S bonds in the proteins and the consequent weakening of gluten matrix. Arakawa and Yonezawa (1975) proved that aggregation parameters of strong wheats are considerably higher than those for weak wheats, therefore, a reduction in aggregation parameters after addition of enzyme demonstrates a weakening of the gluten complex and a consequent lowering in gluten technological characteristics. Disulfidreductase apparently may be used to improve quality of extremely strong gluten.

We have suggested previously the participation of this enzyme in the regulation of SS/SH proportion in reserve proteins in postsynthetic period (Trufanov and Kichatinova 1989). Thiol:proteindisulfide oxidoreductase is likely to play an important role in storage protein degradation during caryopsis sprouting, as the enzyme reaches a fairly high activity in the mature grain.

References.

• Arakawa T and Yonezawa D. 1975. Composition difference of wheat flour glutens in relation to their aggregation behaviors. Agr BiolChem 39:2123-2128.
• Arakawa T, Morishita H, and Yonezawa D. 1976. Aggregation behaviors of glutens, glutenins and gliadins from various wheats. Agr Biol Chem 40:1217-1220.
• Trufanov VA and Kichatinova SV. 1989. Disulfidreductase and thiol oxidase activities of the maturing wheat grain. Prikl Biochim Microbiol 25:361-367.

Disulfide reductase activity and gluten quality in common wheat lines with intervarietal substitutions for chromosomes of homoeologous groups 1 and 6. [p. 145-146]

S.V. Osipova, V.A. Trufanov, and T.A. Pshenichnikova.

The capacity of common wheat, storage proteins for gluten formation is of great importance for breeding. A high storage-protein content is not a guarantee of high gluten quality, the latter being in a substantial dependence on the SS/SH-bond status of these proteins (Bloksma 1975; Kretovich 1991). Wheat grains contain a specific enzyme system belonging to the class of oxidoreductases responsible for thiol-disulfide metabolism in proteins (Trufanov 1994; Trufanov et al. 1999). The study of thiol:protein disulfide oxidoreductase (disulfide reductase, RED, EC 1.8.4.2) and thiol:oxygen oxidoreductase (thioloxidase, EC 1.8.3.2) activities in spring cultivars of wheat with different gluten quality have shown a correlation between the activity and rheological properties of dough. The high genotypic variability in the specific activity of thioloxidase and disulfide reductase was established in 18 common wheat spring cultivars of different origin, indicating the genetic diversity for this character in wheat (Trufanov et al. 2000). Therefore, we were interested in investigating intervarietal substitution lines with pairs of chromosome of a recipient cultivar substituted for with homologues from a donor cultivar. The results of our study of disulfide reductase (RED) activity and some technological characteristics of grain in substitution lines involving chromosomes of homoeologous groups 1 and 6 of common wheat are presented. These chromosomes are known to carry the genes for storage proteins responsible for gluten complex formation (Wrigley and Shepherd 1973).

Materials and Methods. Substitution lines for chromosomes 1A, 1B, 1D, 6A, 6B, and 6D and the double substitution line 1A and 6D (Maystrenko et al. 1998) were used. The cultivar Diamant (Dm), which has one of the highest grain protein contents but poor technological properties, was the recipient cultivar and the high-quality cultivar Novosibirskaya 67 (N67) was the donor. Disulfide reductase activity was determined according the previously described methods (Kichatinova et al. 1993; Trufanov 1994). Technological parameters were studied as described elsewhere (Trufanov et al. 2000). The data was averaged for two independent replicates of the experiment. The activity of disulfide reductase in each was determined three times in two biological and three analytical replicates. The data on specific activity and technological parameters are shown in percent of the recipient cultivar Dm.

Results and Discussion. According to the modern concept, the physical properties of the gluten-protein complex are determined considerably by the content of intra- and intermolecular S-S bonds in the storage proteins. Their formation, breakage, and isomerization are catalyzed by the specific enzyme system of SS/SH metabolism. One of the key enzymes in this system, RED, catalyzes the reaction of reducing the disulfide bonds and, so far, participates in the formation of SH/SS status of storage proteins. The data of Fig. 14 and Fig. 15 show that the DS N67 (1A) Dm (1A) substitution line and the double substitution line DS N67 (1A, 6D) Dm (1A, 6D) have better technological properties, i.e., higher flour strength and extensibility, dough resistance, valorimeter number, and loaf volume and a lower dough dilution. On the whole, the data indicates that in lines with these substitutions, the technological properties have been improved compared to the parental cultivar Dm. At the same time, RED activity was significantly lower in these lines than in the parental. As can be seen from Table 10, RED activity negatively correlates with water-absorbing capacity, dough resistance, and valorimeter number. A positive correlation with dough dilution is observed, which may be connected with the participation of this enzyme in breaking of S-S bonds in the gluten structural matrix.

Introducing the favorable 'a' allele of Glu-A1 into a cultivar genotype, e.g., during the production of intervarietal substitution lines, improves the quality (Mansur et al. 1990). Out data shows another result of substitutions involving chromosome 1A, a change in RED activity followed by an improvement of separate technological properties. We have not found any data supporting the chromosome location of genes for RED in cereals. The significant reduction of RED activity in lines DS N67 (1A) Dm (1A) and DS N67 (1A, 6D) Dm (1A, 6D) allows us to propose that these two chromosomes participate either in the direct genetic control of this enzyme or regulate its activity.

References.

• Bloksma AH. 1975. Thiol and disulfide groups in dough rheology. Cer Chem 52:170-183.
  Kichatinova SV, Trufanov VA, and Permyakov AV. 1993. Thiol oxidase and disulfide reductase activities of wheat cell organelles. Plenum Pub Corp pp. 313-316 (Translated from Prikl Biokhim Mikrobiol 29:412-417).
• Kretovich VL. 1991. The biochemistry of grain and bread. Moscow, Nauka Publ 130 pp. (In Russian).
• Mansur LM, Qualset CO, Kasarda DD, and Morris R. 1990. Effects of 'Cheyenne' chromosomes on milling and baking quality in 'Chinese Spring' wheat in relation to glutenin and gliadin storage proteins. Crop Sci 30:593-602.
• Maystrenko OI, Pshenichnikova TA, Popova OM, Popova RK, Ermakova MF, Arbusova VS, Laykova LI, Efremova TT, and Obukhova LV. 1998. Effects of replacing homoeologous group 1 and 6 chromosomes on the bread-making qualites of common wheat. In: Proc 9th Internat Wheat Genet Symp (Slinkard AE ed). Univ Extension Press, Saskatoon, Saskatchewan, Canada. 4:206-207
• Trufanov VA. 1994. Wheat gluten: problems of quality. Novosibirsk, NaukaPubl, 167 pp. (In Russian).
• Trufanov VA, Kichatinova SV, and Permyakov AV. 1999. Enzymes of the thiol-disulfide exchange in wheat and Their effect on gluten proteins. Prikl Biokhim Mikrobiol 35:219-222 (In Russian).
• Trufanov VA, Kichatinova SV, Kazartseva AT, and Permyakov AV. 2000. Thiol oxidase and disulfide reductase activities of wheat Triticum aestivum L. Caryopsis and its technological quality. Appl Biochem Microbiol 36:76-79 .
• Wrigley CW and Shepherd KW. 1973. Electrofocusing of grain proteins from wheat genotypes. Ann NY Acad Sci 209:154-162.

The relationship between specific lipoxygenase activity and technological characteristics of gluten quality in hexaploid wheat. [p. 147-149]

M.D. Permyakova, V.A.Trufanov, and A.V. Permyakov; and T.A. Pshenichnikova, M.F. Ermakova, A.K. Chistyakova, and L.V. Shchukina (Institute of Cytology and Genetics, Siberian Division of the Russian Academy of Sciences, Novosibirsk, 630090, Russian Federation).

Lipoxygenases (linoleat: oxygen oxidoreductase, Lpx, EC 1.13.11.12 ) are a group of enzymes that catalyze the deoxygenation of polyunsaturated fatty acids containing 1,4-pentadiene system to form a Z,E- conjugated hydroperoxide fatty acid (Grechkin 1998). Lipoxygenases are distributed widely in plants and animals. In animals, lipid hydroperoxides and products of their conversion derived through the Lps pathway are involved in many physiological and pathological processes. Plant lipoxygenase have been implicated in flavor and odor formation. They also may play a role in response to pest attack and wounding (Siedow 1991). Some Lpx isoenzymes also may function as vegetative storage proteins (Tranbarger et al. 1991). The Lpx of wheat is studied mainly in connection with its role in bleaching carotenoid pigment in durum wheat grain (Mc Donald 1979; Pastore et al. 2000). Our interest in Lpx is conditioned by its participation in the formation of superoxide radicals that in vivo may oxidize SH-groups of wheat storage proteins with the formation of inter- and intramolecular disulfide bonds stabilizing gluten protein complexes in hexaploid wheat.

The assessment of potential wheat bread-making quality is based on technological procedures including the evaluation of milling properties of grain and physical properties of flour and dough. Among the milling parameters are 1,000-kernel weight and vitreousness. The first trait is the function of grain size, density, and uniformity and is connected with flour extraction during milling. Vitreousness characterizes endosperm consistency and determines the strength of linking and the ratio between starch granules and protein in endosperm. The physical properties of dough measured with alveograph and farinograph can predict the final bread-making quality of wheat. On the basis of alveograph parameters, wheats are classified as having strong or weak gluten. Farinograph characterizes dough resistance to a long machine processing during technological procedures.

Materials and methods. Seeds of 53 RILs and the parental genotypes of the ITMI mapping population were kindly presented by Andreas Börner (Institut für Pflazengenetik und Kulturpflanzenforschung, Gatersleben, Germany). Lipoxygenase activity was analyzed in Tris-soluble flour extracts according to Doderer et al. (1992). The parameter was determined through formation of conjugated super-peroxide compounds of linoleic acid, registered using spectrophotometer at a wavelength of 234 nm. One unit of activity was defined as the change in optical density on 0.001/one minute. Specific activity was expressed by ratio of activity units to 1 mg of protein in 1 ml of incubation media. Protein concentration was determined by the Lowry method (Lowry et al., 1951). The layout of analysis for most traits of grain and flour qualities in recombinant inbred lines corresponds to the Methods of State Variety Testing of Crops accepted in Russia (Anonymous 1988). Thousand-kernel weight was computed per gram dry weight. To investigate vitreousness, 100 grains of each line were cut and classified according to the type of endosperm as vitreous, semivitreous, or floury. The parameter of vitreousness is the percent of vitreous and half of the semivitreous grains.

To determine the physical properties of dough, grain was milled on the COKB mill with flour extraction of 70 % on average. Analysis was after a 10-day flour tempering following the individual conditioning of grain in each line. M. Chopin alveograph was used to study dough strength. Water absorbing capacity, dough resistance, and valorimeter number were measured with farinograph. Correlation between traits was calculated with the help of the Microsoft Excel 2000 computer program.

Results and discussion. The correlation between specific Lpx activity and some quality characteristics are given in tables. From Table 11, we see that Lpx activity is significantly and positively related to 1,000-kernel weight (0.305*), vitreousness (0.318*), and water-absorbing capacity (0.289*).

Table 12 shows that correlating Lpx activity with technological parameters depends on the value levels of Lpx activity. At low values, the specific level Lpx activity shows no significant correlation. At high values, the level of Lpx activity is positively related to 1,000-kernel weight. The correlation of Lpx activity with such parameters as flour strength, resistance to mixing, and valorimeter number were negative at high Lpx values (-0,402*; -0.389*, and -0.381*, respectively).

Besides yield, the quality of the grains harvested is one of the most important characteristics of the wheat crop. The composition of endosperm storage proteins, gliadins and glutenins, to a great extent determine the final quality parameters of wheat flour (Payne et al., 1979). However, most gluten physical properties correlate with the content of disulfide bonds in the storage proteins, which are responsible for stabilizing space structure of the gluten complex (Lasztity 1980; Trufanov 1994). Wheat seed contains a specific system of enzymes, referred to as an oxidoreductase class, and directly or indirectly regulate thiol-disulfide metabolism in proteins (Shiiba et al. 1991). Some of them catalyze the formation of SS bonds, and the level of their activity correlates with certain technological properties of grain (Trufanov et al. 1999). Lipoxygenase is one of such enzymes that can indirectly, through formation of peroxides and hydroperoxides of unsaturated fatty acids, oxidize SH groups of proteins with the formation of SS bonds. According to our data, we concluded that specific Lpx activity is related to the quality of wheat gluten. This relationship depends on the value levels of Lpx activity. Detailed technological and biochemical analysis of different parameters involved in wheat flour quality seem to be a very productive areas of research and will allow us to more successfully separate the quality into different genetic components and to use molecular techniques to map them for breeding purposes.

References.

• Anonymous. 1988. Methods of State Variety Testing of Crops. Moscow, Gosagroprom Publisher. 122 pp.
• Doderer A, Kokkelink I, Van der Veen S, Valk BE, Schram AW, and Douma AC. 1992. Purification and characterization of two lipoxygenase isoenzymes from germinating barley. Biochim Biophys Acta 1120:97-104.
• Grechkin A. 1998. Recent development in biochemistry of the plant lipoxygenase pathways. Prog Lipid Res 37:317-352.
• Làszity R. 1984. The chemistry of cereal proteins. CRC Press Inc. Boca Raton, FL. 203 pp.
• Lowry OH, Rosebrough NJ, Farr AL, and Randall RJ. 1951. Protein measurement with the folin phenol reagent. J Biol Chem 193:265-275.
• McDonald CE. 1979. Lipoxygenase and lutein bleaching activity of durum wheat semolina. Cereal Chem 56:84-89.
• Payne PI, Jackson LM, Holt EA, and Law CN. 1984. Wheat storage proteins: their genetics and their potential for manipulation by plant breeding. Philos Trans R Soc London, Ser B 304:359-371.
• Pastore D, Trono D, Padalino L, Simone S, Valenti D, Di Fonso N, and Passarella S. 2000. Inhibition by a-tocopherol and L-ascorbate of linoleate hydroperoxidation and b-carotene bleaching activities in durum wheat semolina. J Cereal Sci 31:41-54.
• Shiiba K, Negishi Y, Okada K, and Nagao S. 1991. Purification and characterization of lipoxygenase isozymes from wheat germ. Cereal Chem 68:115-122.
• Siedow JN. 1991. Plant lipoxygenase: structure and function. Ann Rev Plant Physiol Plant Mol Biol 42:145-188.
• Tranbarger TJ, Franceschi VR, Hildebrand DF, and Grimesa HD. 1991. The soybean 94-kilodalton vegetative storage protein 1s a lipoxygenase that 1s localized in paraveinal mesophyll cell vacuoles. Plant Cell 3:973-987.
• Trufanov VA. 1994. Wheat gluten: quality problem. Novosibirsk, Nauka Publisher. 186 pp.
• Trufanov VA, Kichatinova SV, and Permyakov AV. 1999. The enzymes of thiol-disulfide interchange and their effect on gluten proteins. Prikl Biochem and Microbiol 35:219-222.

Characterization of transgenic wheat plants overexpressing chloroplastic iron-superoxide dismutase. [p. 149-152]

Yu.M. Konstantinov, V.M. Sumtsova, E.Yu. Garnik, O.V. Kalyuzhnaya, E.S. Klimenko, V.F. Kobzev (Institute of Cytology and Genetics, Siberian Division of the Russian Academy of Sciences, Institute of Cytology and Genetics, 10 Lavrentyev Av., Novosibirsk, 630090, Russian Federation); and N.V. Pakova, D.V. Nepomnyashchikh, A.I. Katyshev, and R.K. Salyaev.

Earlier studies on genetic modification of plant antioxidant (AO) defense systems led to largely controversial results regarding the possibility of strengthening plant resistance to most frequent stress factors via transferring SOD gene(s) to plants by Agrobacteria-mediated transformation methods (Tepperman et al. 1990; Bowler et al. 1991; Pitcher et al. 1991; Van Camp et al. 1996; McKersey et al. 1996; McKersey et al. 1999). With this in mind, it is of considerable scientific interest both to use alternative methods of plant genetic transformation while introducing AO-defense genes and to enlarge the list of higher plant species used for introduction of relative transgenes. The latter looks particularly important because the systematic and evolutionary position of the species undoubtedly affects transgene manifestation and physiological-biochemical consequences of its introduction in the genome. The present work looks at the acquisition and compilation of physiological-biochemical characteristics of wheat transgenic plants with Arabidopsis FeSOD gene introduced by biolistic transformation.

Materials and methods. Plants of the wheat cultivars Tulunskaya-12 and Skala were used in this research. The procedure for wheat plant transformation by biolistic method is described below. Isolated immature wheat embryos (24-28 days-after-pollination) were placed in Petri dishes 1-2 hours prior to bombardment on an agar medium of the following composition: one-half Murashige and Scoog salts (Murashige and Scoog 1962), 3 % sucrose, 0.125 M sorbite, and 0.125 M mannitol. The extraction of pEXSOD10 plasmid DNA (construct kindly provided by Dr. Marc van Montagu, Gent, Belgium) from JM 103 E. coli cells was performed according to the method (Birnboim and Doly 1979). Tungsten powder with an average particle diameter of 1.1-1.2 mm (BioRad, Emeryville, CA, USA) was used as microbullets. The DNA-tungsten suspension was prepared and placed on microbullets immediately prior to bombardment according to the method of Sanford et al. (1993). Bombardment was performed from the pneumatic gene gun of original design (Siberian Institute of Plant Physiology and Biochemistry of the Russian Academy of Sciences, Irkutsk). Two to three days after control embryos (not subjected to shooting but kept in the same conditions) and transformed embryos were placed in Magenta vessels for sprouting in the light in room conditions on the nutrient medium containing Murashige and Scoog mineral salts with the addition of 3 % sucrose. Immature embryos formed seedlings by direct organogenesis on average in 15 days. In order to obtain fertile plants (R0-plants), 15-20-day-old seedlings were planted in a phytotron in claydite, where nutrient solution was introduced.

DNA was extracted from transformed and control wheat plants according to the method of Konieczny and Ausubel (1993) with small modifications. DNA was analyzed by PCR for the presence of an insertion corresponding to Arabidopsis FeSOD gene using a pair of specific primers synthesized on the basis of cDNA sequence corresponding to the FeSOD gene transcript from A. thaliana (Van Camp et al. 1996)
5' - GATCTAAACTACGTCCTCAAGCCACC - 3' (5' primer) and
5' - GGATCCCACACTCAGAAAAGAGCATG - 3' (3' primer).

In the course of DNA analysis by PCR, we also was used an alternative approach. A pair of primers (so-called combined primers) specific to the fragment embracing the 3' region of the Arabidopsis FeSOD gene and the 5' region of neomycin phosphotransferase II gene (NPT II) within the insertion
5' - GGTGGCTTGAGGACGTAGTTTAGATC - 3' (5' primer) and
5' - GATGCGCTGCGAATCGGG - 3' (3' primer).

PCR was in 25 ml tubes containing 50 ng of wheat DNA, 2.5 units of Taq polymerase, 0.2 mM dNTPs, 2mM MgCl2, 0.4 pmol/ml of each primer, and 2.5 ml 10 X buffer for Taq polymerase (buffer composition: 670 mM Tris-HCl, pH 8.8, 166 mM (NH4)2SO4, 0.1 % Tween 20). After DNA denaturation at 94 C within 5 min, 36 amplification cycles were conducted (denaturation at 94°C, 0.7 min, annealing at 55 C, 1.0 min, extension at 72 C, 1.5 min). The reaction was completed by heating at 72 C within 10 minutes. Amplification products were separated by electrophoresis in 1 % agarose gels, dyed with ethidium bromide, and photographed in UV-light.

SOD activity was determined according to the method of Paoletti et al. (1986). Protein concentration was determined by the method of Lowry et al. (1951) using bovine serum albumin as a standard. The plants were tested for resistance to increased concentrations of superoxide radicals via exposition of leaf discs of control and transformed plants in 0.1 % Tween 20 solution with addition of different paraquat concentrations (0.1-1.0 mM).

Results and discussion. In pEXSOD10, the genetic control is by the 35S promoter of cauliflower mosaics virus. Unlike agrobacterial transformation in earlier investigations of plant species with Sod genes (Tepperman et al. 1990; Bowler et al. 1991; Pitcher et al. 1991; Van Camp et al.1996; McKersey et al. 1996; McKersey et al. 1999), our present research attempted to transform wheat by biolistic method.

Immature isolated embryos of the spring wheats Tulunskaya-12 and Skala were used for genetic transformation. After biolistic transformation, immature wheat embryos of test and control groups formed plants (R0). Electrophoretic analysis of PCR products obtained by amplification, using DNA of transformed and control wheat plants of Tulunskaya-12 as a template, demonstrated the presence of a relevant size (~ 820 bp) DNA-insertion in plant regenerants, unlike those of control group (Fig. 16). In the course of our PCR-analysis of DNA of transformed and control plants, we used two pairs of primers, which allowed us to analyze different regions of the insertion carrying FeSOD A. thaliana gene. Although the first pair of oligonucleoitides was selected for the analysis of the proper coding part of Arabidopsis FeSOD gene (Fig. 16), the second pair (so-called combined primers) allowed us to identify the presence of a DNA fragment embracing the 5' region of the Arabidopsis FeSOD gene and the 5' region of NPT II gene inside the insertion. The results of the PCR analysis of DNA from transformed and control plants of Skala wheat using combined primers confirmed the presence of a corresponding polynucleotide insertion of 2.5 kb in the transformed plants (Fig. 17).

In our view, using combined primers made possible a much more reliable identification of transgenic insertion. Total SOD activity in the transformed wheat plants of Tulunskaya 12 was found to exceed the same parameter in the plants of control group by 30 % (Table 13). Nevertheless, we found no differences in the total SOD activity in the seedlings of the R0 generation of test and control groups of Skala wheat (data not presented). Transformed plants of both Skala (Fig. 18) and Tulunskaya 12 (Fig. 19) wheat possessed much higher (as compared to control) antioxidant activity manifested for all paraquat concentrations used (0.1-1.0 mM).

Biolistic transformation of immature wheat embryos with the pEXSOD10 construct provided the transfer of the Arabidopsis FeSOD gene to wheat plants. The result was an increase of total SOD activity in seedlings and an enhanced resistance to paraquat in mature plants. During ontogenesis, transformed wheat plants of the R0 generation demonstrated normal growth and development and produced seeds.

Acknowledgments. The authors are indebted to Prof. Marc van Montagu and his colleagues for kindly providing pEXSOD10 construction used in this study.

References.

• Birnboim HC and Doly J. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nuc Acids Res 7:1513-1523.
• Bowler C, Slooten L, Vandenbranden S, De Rycke R, Botterman J, Sybesma C, Van Montagu M, and Inze D. 1991. Manganese superoxide dismutase can reduce cellular damage mediated by oxygen radicals in transgenic plants. EMBO J 10:1723-1732.
• Konieczny A and Ausubel FM. 1993. A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J 4:403-410.
• Lowry OH, Rosebrough NJ, Farr AL, and Randall RJ. 1951. Protein measurement with folin phenol reagent. J Biol Chem 193:265-275.
• McKersie BD, Bowley SR, Harjanto E, and Leprince O. 1996. Water deficit tolerance and field performance of transgenic alfalfa overexpressing superoxide dismutase. Plant Physiol 111:1177-1181.
• McKersie BD, Bowley SR, and Jones KS. 1999. Winter survival of transgenic alfalfa and field performance of transgenic alfalfa overexpressing superoxide dismutase. Plant Physiol 119:839-847.
• Murashige T and Scoog FA. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:153-162.
• Paoletti F, Aldinucci D, Mokali A, and Caparrini A. 1986. A sensitive spectrophotometric method for the determination of superoxide dismutase activity in tissue extracts. Anal Biochem 154:536-541.
• Pitcher LH, Brennan E, Hurley A, and Dunsmuir P. 1991. Overproduction of petunia chloroplastic copper/zinc superoxide dismutase does not confer ozone tolerance in transgenic tobacco. Plant Physiol 97:452-455.
• Sanford JC, Smith FD, and Russel JA. 1993. Optimizing the biolistic process for different biological applications. Meth Enzymol 217:483-509.
• Tepperman JM and Dunsmuir P. 1990. Transformed plants with elevated levels of chloroplastic SOD are not more resistant to superoxide toxicity. Plant Mol Biol 14:501-511.
• Van Camp W, Capiau K, Van Montagu M, Inze D, and Slooten L. 1996. Enhancement of oxidative stress tolerance in transgenic tobacco plants overproducing Fe-supeoxide dismutase in chloroplasts. Plant Physiol 112:1703-1714.
  

VAVILOV INSTITUTE OF GENERAL GENETICS, RUSSIAN ACADEMY OF SCIENCES
Gubkin str. 3, 119991 Moscow, Russian Federation.

SHEMYAKIN AND OVCHINNIKOV INSTITUTE OF BIOORGANIC CHEMISTRY, RUSSIAN ACADEMY OF SCIENCES2
Ul. Miklukho-Maklaya 16/10, Moscow, Russian Federation.

Analysis of antimicrobial peptides from seeds of Triticum kiharae Dorof. et Migusch. [p. 152-153]

T.I. Odintsova and V.A. Pukhalskiy (Vavilov Institute of General Genetics) and A.K. Musolyamov and Ts.A. Egorov (Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry).

All living organisms have evolved different defense mechanisms against pathogen attack. The synthesis of antimicrobial peptides belongs to the most widespread and ancient defense strategies. Eight families of antimicrobial peptides, ranging in size from 2 to 9 kD, have been identified in plants (Garcia-Olmedo et al. 1998). These peptides are thionins, defensins, lipid-transfer proteins, hevein, and the knottin-like peptides, MBP1, IbAMP, and snakins. All have compact structures stabilized by 2-8 disulfide bonds and represent permanent and inducible defense barriers. Considerable progress has been made recently in the identification of antimicrobial peptides in different plant species. However, wild relatives of wheat and related species are poorly studied. In this work, we analyzed the peptide composition of seeds of T. kiharae, which is highly resistant to most fungal pathogens.

Materials and methods. The peptide fraction was extracted from T. kiharae flour with acid (1 % trifluoroacetic acid, 1 M HCl, and 5 % HCOOH) for 1 h at room temperature. The extract was subjected to chromatography on Heparin Sepharose. Proteins and peptides were eluted with a stepwise NaCl gradient. The fraction was eluted with 100 mM NaCl and further separated on a Superdex peptide column followed by RP-HPLC chromatography of the peptide fraction. The chromatographic fractions were tested for the antifungal activity against H. sativum and characterized by mass spectrometry (MS) and sequencing.

Results and discussion. The analysis of the peptide fraction by MS and N-terminal sequencing showed that seeds of T. kiharae contain several families of antimicrobial peptides with molecular masses from 3 to 6 kD. We isolated two thionins whose N-terminal sequences differed from the sequences determined earlier for the hexaploid seeds of the Aegilops-Triticum group, four new glycine-rich peptides, six new defensins, two new hevein-like peptides, two lipid-transfer proteins, and several peptides whose N-terminal sequences revealed no homology to the known proteins. Tests for the antifungal activity of the glycine-rich peptides found earlier in the roots of only shepherd's purse (Capsella bursa-pastoris) (Park et al. 2000) showed that they caused morphological changes in the filamentous fungus H. sativum. Defensins isolated from T. kiharae seeds had no effect on the growth and morphology of this fungus.

Our data indicate that T. kiharae is a valuable source of antimicrobial peptides, whose biological activities will be investigated in more detail.

References.

• Garcia-Olmedo B, Molina A, Alamillo J, and Rodriguez-Palenzuela P. 1998. Plant defense peptides. Biopolymers. Peptide Sci 47:479-491.
  
• Park CJ, Park CB, Hong S-S, Lee H-S, Lee SY, and Kim SC. 2000. Characterization and cDNA cloning of two glycine- and histidine-rich antimicrobial peptides from the roots of shepherd's purse, Capsella bursa-pastoris. Plant Mol Biol 44:187-197.
  

N.I. VAVILOV RESEARCH INSTITUTE OF PLANT INDUSTRY
42, B. Morskaya Str., St. Petersburg, 190000, Russian Federation.

A genealogical analysis of the genetic diversity in Russian spring durum cultivars. [p. 153-157]

S.P. Martynov and T.V. Dobrotvorskaya.

We studied the genetic diversity of the Russian spring durum cultivars with the help of a genealogical analysis. The 79 spring durum cultivars released in the Russian Federation between 1929 and 2003 are given in Table 1. Three cultivars with incomplete pedigrees (Zarnitsa Altaya, Omskaya Yantarnaya, and Orenburgskaya 21) were excluded from the analysis. The dynamics of change in diversity over space and time were estimated on genetic profiles. Pedigree analysis, calculation of coefficients of parentage matrix, and genetic profiles were made with the aid of the Information and Analytical System of Genetic Resources of Wheat GRIS 3.5 (Martynov and Dobrotvorskaya 2000).

We have constructed the genetic profiles for 76 cultivars to analyze change in diversity. The pool of original ancestors of Russian spring durum wheats for the period in totals 92 landraces and old cultivars, including 41 from the Russian Federation. More than half were derived from the original ancestors from European countries (57 %), including 45 % from the Russian Federation and the Ukraine. The number of ancestors from other continents is less: Asia, 24 %; United States, 12 %; and Africa, 7 %. The number of lines with unknown pedigrees is rather small (11.9 %). The original ancestors strongly differ in frequency and, thus, on their importance in the gene pool of Russian spring durum wheats. Landraces, usually indicated with an LV-, such as Beloturka, Sivouska, and Kubanka; original ancestors of Kharkovskaya 46 (LV-Volga region, LV-T. turgidum, and LV-T. dicoccum from the Kharkov province), and LV-Zolochevskij district (via Narodnaya); original ancestors of Melanopus 1932; Zabajkalskaya polba; Yaroslav emmer; and the T. aestivum cultivar Poltavka are found in the pedigrees more than half of cultivars created in various institutes. About half of original ancestors (46 %) are present in the pedigrees of only 1-2 cultivars (frequency of presence < 3 %). The average contribution of an original ancestor varies from 0.0932 for the LV-Volga region to 0.0001 for Carosella.

The tendency of change in diversity over time is revealed by the analysis of a series of matrixes 'n x m', where n is the number of released cultivars and m is the number of original ancestors. For this analysis, we constructed genetic profiles for all cultivars that were released in the Russian Federation between 1929 and 2003 and generated 75 matrixes. We now can see changes in the structure of the original ancestors in sets of cultivars released in any one year (see Fig. 1). The pool of original ancestors of the Russian spring durum cultivars for all periods totaled 92 landraces and old cultivars. The process of accumulating landraces in pedigrees (top curve) was accompanied by their loss (bottom curve). The result was that the actual number of landraces in pedigrees over the years increased from four in 1930 to 71-73 in 2000.

The dynamics of the average genetic profile for released cultivars, i.e., an average of the number of original ancestors/pedigree, showed that until 1970, pedigrees contained only 1-2 landraces or old cultivars. Since 1970, pedigrees have become complicated, and the average number of original ancestors/cultivar increased. The genetic profiles of modern Russian spring durum cultivars in the 2000s include, on average, 9-10 original ancestors. The Shannon diversity index increased over the years from H = 1.20 in the 1930s to 2.90 in 2000s. Thus, during last 75 years, an increase in genetic diversity took place. A detailed analysis during this period, however, indicated that about 20 landraces were lost (Table 2). The lost part makes up 20 % of the pool of original Russian wheat ancestor cultivars. We assume that some of them carry a complex of genes for adaptability to specific climatic conditions of the Russian Federation.

Thus, in addition to the increase in genetic diversity, there is genetic erosion of local material in gene pool of the Russian spring durum wheats.

Comparison of the diversity in spring durum cultivars developed by various institutes. For this analysis, we looked at the cultivars of six of the most productive breeding institutes, Agricultural Research Institute for South-East (Saratov), Krasnyj Kut Breeding Station (Saratov province), Samara Agricultural Research Institute, Siberian Agricultural Research Institute (Omsk), Agricultural Research Institute for Central Chernozem Region (Voronezh province), and the Ukrainian Research Institute of Plant Production (Kharkov). The number of cultivars from other institutes was not sufficient for statistical analysis.

To the analysis of the specificity of the distribution of original ancestors in breeding programs of various institutes, we applied a two-way ANOVA of the contributions of dominant ancestors in unorganized replications (Table 3). Twelve landraces with the maximum frequency of presence (not less than 50 % in cultivars developed in one or more institutes) were used. The factors investigated were institute (factor A) with gradation number a = 6 and dominant original ancestors (factor B) with gradation number b = 12. The influence of both factors and their interaction was significant. A significant interaction (A x B) shows a distinction in the contribution of dominant ancestors in cultivars developed by various institutes and, thus, the specificity of original ancestors in the different breeding programs (Table 4).

The most important ancestors at the Ukrainian Research Institute of Crop Production are original ancestors of the cultivar Kharkovskaya 46 (landraces LV-Volga region, LV-T. turgidum, and LV-T. dicoccum from Kharkov province), and LV-Zolochevskij district of the Kharkov province via cultivar Narodnaya. Among the cultivars developed at Krasnyj Kut Breeding Station, dominant roles belong to Sivouska, the LV-Novouzensk district of the Saratov province, landraces Melanopus and Hordeiforme from the Krasnyj Kut district via cultivar Melanopus 1932, and Kubanka. Sivouska and Beloturka prevail in cultivars of the Samara Agricultural Research Institute. A feature of the Samara breeding program was wide use of Poltavka and landrace T. aestivum L. from Saratov province, which enters into pedigrees all released cultivars. In cultivars from the Agricultural Research Institute for South-East Regions, the highest frequency and greatest average contribution is from landraces from Saratov province. Beloturka has high quality grain. The landrace of next importance is Sivouska. In cultivars from the Ukrainian Research Institute of Crop Production and the Agricultural Research Institute for Central Chernozem Region, the ancestors of the greatest importance are those of cultivar Kharkovskaya 46. Also important ancestors in cultivars from this institute are Kubanka and Zabajkalskaya polba (T. dicoccum). In cultivars of the Siberian Agricultural Research Institute, no dominant ancestors are obvious based on the frequency of presence or the average contribution, although the general number exceeds 37 for the number of original ancestors in released cultivars of other institutes (the Krasnyj Kut Breeding Station, 13 landraces; the Agricultural Research Institute for South-East Regions, 20 landraces; the Agricultural Research Institute for Central Chernozem Region, 21 landraces; and the Samara Agricultural Research Institute, 29 landraces).

The similarity of cultivars developed within the framework of the various breeding programs have an effect on the coefficient of parentage between all possible pair combinations. The ANOVA of coefficient of parentage (Table 5) shows the high significance of distinction between institutes. The genetic similarity of cultivars developed at the various breeding institutes differ significantly (Table 6).

The greatest similarity is that of half-sibs of cultivars developed at the Ukrainian Research Institute of Plant Production. The high value for the average coefficient of parentage for the set of Kharkov cultivars shows that during several decades, continuity in the breeding programs was kept. Cultivars developed at Krasnyj Kut Breeding Station and the Siberian Agricultural Research Institute have the least similarity and, thus, higher diversity. An intermediate position is occupied by cultivars from the Samara, South-East, and Central Chernozem Agricultural Research Institutes. The diversity of cultivars from these breeding centers is estimated by approximately identical average coefficient of parentage. Cultivars developed at the Samara and Saratov Agricultural Research Institutes have the greatest Shannon diversity index and those from the Ukrainian Research Institute the least (Table 6).

References.

• Martynov SP and Dobrotvorskaya TV. 2000. A study of genetic diversity in wheat using the Genetic Resources Information and Analysis System GRIS. Rus J Genet 36:195-202.