PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:56592 Links A009B22 Homo sapiens chromosome 10, locus FAM13C Macaca mulatta chromosome 9, locus LOC702439 Pan troglodytes chromosome 10, locus LOC450475 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GTATCAGACCAGAAGGAGTT Reverse primer: ACCAGATGAAAAGAAAGAAG PCR product size: 120 (bp), Homo sapiens    Homo sapiens Name: A009B22 Also known as: Polymorphism info:   Cross References Gene GeneID: 220965   Symbol: FAM13C   Description: family with sequence similarity 13, member C   Position: 10q21.1 UniGene Hs.607594 Family with sequence similarity 13, member C1 Mapping Information A009B22 Sequence Map: Chr 10|Celera Map Viewer   Position: 54278631-54278750 (bp)   A009B22 Sequence Map: Chr 10|HuRef Map Viewer   Position: 55003550-55003669 (bp)   A009B22 Sequence Map: Chr 10 Map Viewer   Position: 60682511-60682630 (bp)   A009B22 NCBI RH Map: Chr 10 Map Viewer   Position: 735.7 (cR)   Lod score: 1.70   A009B22 GeneMap99-GB4 Map: Chr 10 Map Viewer   Position: 344.08 (cR3000)   Lod score: 0.20   Reference Interval: D10S539-D10S549 Electronic PCR results Genomic (5 of 8)[Show All Hits] G32383.1 1 .. 120 (120 bp)   AC025038.6 93085 .. 93204 (120 bp)   CH003457.1 54308218 .. 54308337 (120 bp)   CH003505.1 56679003 .. 56679122 (120 bp)   CH471083.1 8472874 .. 8472993 (120 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC021447.3 13270 .. 13389 (120 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC021936.2 70383 .. 70502 (120 bp)     ESTs (4) T66266.1 129 .. 248 (120 bp)   F12218.1 152 .. 271 (120 bp)   H18544.1 151 .. 270 (120 bp)   BF347380.1 483 .. 602 (120 bp)     Whole Genome Shotgun sequences (4) AADD01107691.1 61928 .. 62047 (120 bp)   AADC01090881.1 42580 .. 42699 (120 bp)   AADB02013097.1 319035 .. 319154 (120 bp)   ABBA01019446.1 66072 .. 66191 (120 bp)        Macaca mulatta Name: A009B22 Polymorphism info:   Cross References Gene GeneID: 702439   Symbol: LOC702439   Description: similar to Protein FAM13C1   Position:   Mapping Information A009B22 Sequence Map: Chr 9 Map Viewer   Position: 78033734-78033853 (bp)    Pan troglodytes Name: A009B22 Polymorphism info:   Cross References Gene GeneID: 450475   Symbol: LOC450475   Description: hypothetical LOC450475   Position:   Mapping Information A009B22 Sequence Map: Chr 10 Map Viewer   Position: 58086892-58087011 (bp) Electronic PCR results Genomic (1) CM000324.1 58086892 .. 58087011 (120 bp)     Whole Genome Shotgun sequences (2) AADA01300472.1 7200 .. 7319 (120 bp)   AACZ02114156.1 29638 .. 29757 (120 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement