PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:71859 Links RH79135 Homo sapiens chromosome 12, locus SLC6A12 Pan troglodytes chromosome 12, locus LOC467192 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TGCCATCCTGCTTCTAACG Reverse primer: CTTGTTAACTAAGGCAGGGGG PCR product size: 186 (bp), Homo sapiens    Homo sapiens Name: RH79135 Also known as: stSG43183 stSG45292 Polymorphism info:   Cross References Gene GeneID: 6539   Symbol: SLC6A12   Description: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12   Position: 12p13 UniGene Hs.437174 Solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member... Mapping Information RH79135 Sequence Map: Chr 12|HuRef Map Viewer   Position: 151989-152174 (bp)   RH79135 Sequence Map: Chr 12 Map Viewer   Position: 169528-169713 (bp)   RH79135 Sequence Map: Chr 12|Celera Map Viewer   Position: 1907884-1908069 (bp)   stSG45292 NCBI RH Map: Chr 12 Map Viewer   Position: 17.2 (cR)   Lod score: 1.01   stSG45292 GeneMap99-GB4 Map: Chr 12 Map Viewer   Position: 14.49 (cR3000)   Lod score: 0.00   Reference Interval: D12S91-D12S1608 Electronic PCR results RefSeq mRNA (3) NM_003044.3 3170 .. 3355 (186 bp)   NM_001122847.1 2927 .. 3112 (186 bp)   NM_001122848.1 3053 .. 3238 (186 bp)     mRNA (4) U27699.1 3209 .. 3394 (186 bp)   AK096046.1 1793 .. 1978 (186 bp)   AK125026.1 3371 .. 3556 (186 bp)   AK131564.1 2569 .. 2611 (43 bp)     Genomic (5 of 9)[Show All Hits] G21338.1 19 .. 204 (186 bp)   AC007406.1 17024 .. 17209 (186 bp)   CH003459.1 235125 .. 235310 (186 bp)   CH003507.1 201432 .. 201617 (186 bp)   CH471116.2 111466 .. 111651 (186 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC016741.7 104721 .. 104906 (186 bp)     ESTs (5 of 22)[Show All Hits] H55769.1 19 .. 204 (186 bp)   H70327.1 22 .. 207 (186 bp)   H70439.1 19 .. 204 (186 bp)   N49856.1 25 .. 210 (186 bp)   AA707164.1 13 .. 199 (187 bp)     Whole Genome Shotgun sequences (4) AADD01120692.1 26138 .. 26323 (186 bp)   AADC01103255.1 78064 .. 78249 (186 bp)   AADB02014528.1 753085 .. 753270 (186 bp)   ABBA01048857.1 88328 .. 88513 (186 bp)        Pan troglodytes Name: RH79135 Polymorphism info:   Cross References Gene GeneID: 467192   Symbol: LOC467192   Description: hypothetical LOC467192   Position:   Mapping Information RH79135 Sequence Map: Chr 12 Map Viewer   Position: 194998-195183 (bp) Electronic PCR results RefSeq mRNA (1) XR_023913.1 4149 .. 4334 (186 bp)     Genomic (1) CM000326.1 194998 .. 195183 (186 bp)     Whole Genome Shotgun sequences (2) AADA01184255.1 5225 .. 5410 (186 bp)   AACZ02131229.1 6787 .. 6972 (186 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement