Join Evaluation Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <100 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Curator Links

Add/Update certificate

Alignment for AL731558.14 and AL731734.13

AL731558.14 Mouse DNA sequence from clone RP23-235D11 on chromosome 2 Contains a novel gene, complete sequence [htgs_phase3]

Length: 222,163 bp

AL731734.13 Mouse DNA sequence from clone RP23-26C7 on chromosome 2 Contains one CpG island, complete sequence [htgs_phase3]

Length: 88,618 bp

Alignment Summary

Join evaluation: green

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 2263
Total Length: 2000
Aligned Length: 2000
Percent Identity: 100
Number of Gaps: 0
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Alignment 1 of 1

 Mismatches = 0, Gaps = 0, Length = 2000
 Percent identity = 100%
 Score = 3965 bits (2000), Expect = 0
  1 BAC and 2 Fosmid bridging clones.
  1 BAC and 2 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL731558.14 >220164  aatgtgtattatattctgctccacaacacttgacaataagtacgaagaggtccaatacac 220223 
AL731734.13 >1       ............................................................ 60     

AL731558.14 >220224  cagaaagaagcactcatgcctgacctttttcttcaacctcttccccagttttcatattga 220283 
AL731734.13 >61      ............................................................ 120    

AL731558.14 >220284  gttggctcataacattcgcgcccccccccatcctaggtaattgaattaaaatgctagtgg 220343 
AL731734.13 >121     ............................................................ 180    

AL731558.14 >220344  taaagaaacttcattctctctcctatttgagatataaatgaaaaacttttgcacatgcaa 220403 
AL731734.13 >181     ............................................................ 240    

AL731558.14 >220404  aggaacattttaataatatattaggaaaatagagaataattccaatcatgaagtaacttt 220463 
AL731734.13 >241     ............................................................ 300    

AL731558.14 >220464  ccatgatgaagagtcagtaggacctttctcaaactatagcaccacagcctccatgatgga 220523 
AL731734.13 >301     ............................................................ 360    

AL731558.14 >220524  tacaggaaagacagcatttttgaactggtagggagtgaaattagtaaaaggcacttagga 220583 
AL731734.13 >361     ............................................................ 420    

AL731558.14 >220584  acttctgttgctataaaattctttttctttctttctttctttctttctttctttctttct 220643 
AL731734.13 >421     ............................................................ 480    

AL731558.14 >220644  ttctttctttctctctctctctctctctctttctttctttctttccatttctctcttcct 220703 
AL731734.13 >481     ............................................................ 540    

AL731558.14 >220704  tcatctcttttttttctctgtttgataataaaaaagtattatattgcaagtctgaaagtt 220763 
AL731734.13 >541     ............................................................ 600    

AL731558.14 >220764  tctgtagtaaaaatccaacaaccagaaataaggtttcattagtccttccatgataaactg 220823 
AL731734.13 >601     ............................................................ 660    

AL731558.14 >220824  gggaaaacaaaagagaaaactggagaagattgtttctgaggttgcgttttccatttttta 220883 
AL731734.13 >661     ............................................................ 720    

AL731558.14 >220884  cctggaggaaaataaatgccttttagattctgctttagatctcagtgaatgatcccatat 220943 
AL731734.13 >721     ............................................................ 780    

AL731558.14 >220944  taggccttcaaatgtgttgtttgaatctcccttgaaaaatttggctggagagtaagcaat 221003 
AL731734.13 >781     ............................................................ 840    

AL731558.14 >221004  ctgatagaattctcatgcattcatatgtcagacttggccgaactttagatgtgggctgtc 221063 
AL731734.13 >841     ............................................................ 900    

AL731558.14 >221064  tctctgacacctttcataggccttaaacaacttaggatctgagccatgatgaaaagaagc 221123 
AL731734.13 >901     ............................................................ 960    

AL731558.14 >221124  cactgtgcaaacaaagacttggggctccaggcattgactttctgcctctctggtcccctt 221183 
AL731734.13 >961     ............................................................ 1020   

AL731558.14 >221184  tcaatcttgccatcttttaggatttcgcttggtgtttgatacagcttttcagagacttaa 221243 
AL731734.13 >1021    ............................................................ 1080   

AL731558.14 >221244  tagctgttcggttatactgtgtaagaaaaggaacatggccaggattgattggctgtgcgc 221303 
AL731734.13 >1081    ............................................................ 1140   

AL731558.14 >221304  tggctggactcaaagtgtctgtggaaccttctgccttacttagcagtttaactctttgta 221363 
AL731734.13 >1141    ............................................................ 1200   

AL731558.14 >221364  gtaaaaataccatcccctcctagtgagaatcaaacagacatgtattagcagttccacgct 221423 
AL731734.13 >1201    ............................................................ 1260   

AL731558.14 >221424  gttacaaagaaagagggacttggtggaacttctgtagatcattctgaccattgtgtcttt 221483 
AL731734.13 >1261    ............................................................ 1320   

AL731558.14 >221484  ccttgtaaactttgatatttggaaagtgctgagagagttcagagggactggaagaaatca 221543 
AL731734.13 >1321    ............................................................ 1380   

AL731558.14 >221544  gaggggtgtacattcagagggcacaggtgcttcagagctttagtttcatttctggctgag 221603 
AL731734.13 >1381    ............................................................ 1440   

AL731558.14 >221604  ctctaggtctgctgatgaaggccatgcttagctacattgatggcttgcccttccctccag 221663 
AL731734.13 >1441    ............................................................ 1500   

AL731558.14 >221664  cccttatggatttgatatctttgcttactaaagctctgtgcctgttttaatcagtcataa 221723 
AL731734.13 >1501    ............................................................ 1560   

AL731558.14 >221724  aactaactaagacattgagagagggtaactaaatttctcttttttaaaaaaaaaaattcc 221783 
AL731734.13 >1561    ............................................................ 1620   

AL731558.14 >221784  tccttgggaaatgaaaataccagttactcatggcacatattggtagtagtgcattacatg 221843 
AL731734.13 >1621    ............................................................ 1680   

AL731558.14 >221844  actttagctactttaaatattggggtgactggttgcgatatatcccactagccaaatctg 221903 
AL731734.13 >1681    ............................................................ 1740   

AL731558.14 >221904  tgcatctactagatgtgttgagtaacatcgacttattattaataattctatatgacattc 221963 
AL731734.13 >1741    ............................................................ 1800   

AL731558.14 >221964  caaaacaagaaataaacataaaaaatgaaagaatttatatcttatggtttctacagaaaa 222023 
AL731734.13 >1801    ............................................................ 1860   

AL731558.14 >222024  ccaaaacatcttgtaaaacatagaaaagcctgaacttaggtttgtaaagagttgaaaatc 222083 
AL731734.13 >1861    ............................................................ 1920   

AL731558.14 >222084  tccagaataggaaagaagatacagcttggaaaaaaaagagagagacatgctttcttccag 222143 
AL731734.13 >1921    ............................................................ 1980   

AL731558.14 >222144  caactgtgctgatggaattc 222163 
AL731734.13 >1981    .................... 2000

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time
A	222163	2001	+	+	chenhc	Taxid 10090 chrom 2 Reference assembly	2008-11-20 16:50:08.036

Events

Id	Type	Date	Whodid	Comment
4339	ImportOldDb	09/02/2005 14:01:00	f_old_db
4340	ReSetShortOvlp	09/04/2008 10:31:48	dbo
166389	CreateSwitchPt	11/20/2008 16:50:08	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-178G12	AL731558.14	99.84%	pos 25293 (R+)
C3H-37P17				AL731558.14	99.73%	pos 177946 (F+)
CH29-173N17	AL731558.14	99.11%	pos 181733 (R+)
CH29-575H5	AL731734.13	99.74%	pos 2069 (R+)
CH29-601K8	AL731558.14	99.86%	pos 131546 (R-)
RP23-32E21	AL731558.14	99.12%	pos 102195 (R+)
RP23-332G21	AL731734.13	99.61%	pos 87426 (R+)
RP24-154K24	AL731734.13	99.11%	pos 60236 (R-)
RP24-164I24	AL731734.13	99.83%	pos 17642 (R-)	AL731558.14	99.76%	pos 92359 (F+)
RP24-253N13				AL731558.14	99.69%	pos 1788 (F-)
RP24-325P14				AL731558.14	99.02%	pos 24682 (F-)
RP24-92O3	AL731734.13	99.24%	pos 17473 (R+)	AL731734.13	99.63%	pos 36540 (F-)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-113C14	AL731558.14	100%	pos 162221 (R+)
WI1-1177A14	AL731558.14	100%	pos 152948 (R-)	AL731558.14	100%	pos 111284 (F+)
WI1-1196A4	AL731558.14	99.64%	pos 163065 (R+)
WI1-1199M24	AL731558.14	99.45%	pos 114332 (R-)	AL731558.14	100%	pos 80434 (F+)
WI1-1199P5	AL731558.14	99.74%	pos 114356 (R-)	AL731558.14	100%	pos 80425 (F+)
WI1-1303F19	AL731558.14	100%	pos 165949 (R-)
WI1-1312M3				AL731558.14	100%	pos 32809 (F-)
WI1-131O18	AL731734.13	99.4%	pos 81260 (R+)
WI1-1427E23				AL731558.14	99.18%	pos 221187 (F-)
WI1-1427E23				AL731734.13	99.18%	pos 1024 (F-)
WI1-1427M23	AL731558.14	99.01%	pos 179537 (R+)	AL731558.14	99.64%	pos 221195 (F-)
WI1-1427M23				AL731734.13	99.64%	pos 1032 (F-)
WI1-1523F8	AL731558.14	100%	pos 212280 (R+)
WI1-1765F21	AL731558.14	99.81%	pos 21977 (R-)
WI1-1795J24	AL731558.14	99.31%	pos 133577 (R+)	AL731558.14	99.85%	pos 175680 (F-)
WI1-1811J10	AL731558.14	100%	pos 166773 (R-)	AL731558.14	100%	pos 128943 (F+)
WI1-1881E15	AL731558.14	100%	pos 158868 (R+)	AL731558.14	100%	pos 203340 (F-)
WI1-1898I18				AL731558.14	100%	pos 52888 (F+)
WI1-2019G3	AL731558.14	100%	pos 131700 (R+)	AL731558.14	99.82%	pos 169397 (F-)
WI1-2036D21	AL731558.14	99.74%	pos 170982 (R+)	AL731558.14	100%	pos 212800 (F-)
WI1-2084I17	AL731734.13	99.72%	pos 85541 (R-)	AL731734.13	100%	pos 44441 (F+)
WI1-211L8	AL731558.14	100%	pos 29834 (R-)
WI1-2129M6	AL731558.14	99.75%	pos 132437 (R-)	AL731558.14	100%	pos 90919 (F+)
WI1-2175F17				AL731734.13	100%	pos 75484 (F+)
WI1-2237J6				AL731558.14	100%	pos 30218 (F-)
WI1-2247C6				AL731558.14	99.71%	pos 196674 (F-)
WI1-228H18	AL731734.13	99.62%	pos 70551 (R-)	AL731734.13	99.52%	pos 29445 (F+)
WI1-2472A6	AL731558.14	99.77%	pos 76457 (R-)	AL731558.14	100%	pos 36257 (F+)
WI1-2682I18	AL731734.13	100%	pos 33216 (R-)	AL731558.14	100%	pos 209602 (F+)
WI1-2876K14	AL731558.14	100%	pos 73383 (R-)	AL731558.14	99.81%	pos 32746 (F+)
WI1-363H2	AL731558.14	100%	pos 153227 (R-)	AL731558.14	100%	pos 113482 (F+)
WI1-36C3	AL731558.14	99.28%	pos 158083 (R+)
WI1-531C1	AL731558.14	99.58%	pos 149569 (R+)	AL731558.14	100%	pos 192629 (F-)
WI1-569B20	AL731558.14	99.66%	pos 124762 (R+)
WI1-633G11	AL731558.14	99.76%	pos 183565 (R-)	AL731558.14	100%	pos 141349 (F+)
WI1-756P20	AL731558.14	100%	pos 197170 (R-)	AL731558.14	100%	pos 153582 (F+)
WI1-817G8	AL731734.13	100%	pos 44080 (R+)	AL731734.13	100%	pos 84629 (F-)
WI1-817G8				AL731734.13	100%	pos 85711 (F-)
WI1-850B16	AL731558.14	100%	pos 149009 (R+)
WI1-899N12	AL731558.14	100%	pos 89482 (R-)	AL731558.14	99.16%	pos 47113 (F+)
WI1-908A24	AL731558.14	99.43%	pos 173883 (R+)	AL731558.14	99.49%	pos 211682 (F-)

NCBI

Join Evaluation Legend

Curator Links

Alignment for AL731558.14 and AL731734.13

Alignment Summary

Alignment 1 of 1