PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:62217 Links D5S1620E Homo sapiens chromosome 5 Pan troglodytes chromosome 5, locus LSM11 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TAGCAGCAATTCTCCCTAGAC Reverse primer: GGCTAAACCTGAATGACTCTAC PCR product size: 145 (bp), Homo sapiens    Homo sapiens Name: D5S1620E Also known as: Cda0if11 GDB:442932 GDB:448588 Polymorphism info:   Cross References UniGene Hs.23648 CDNA FLJ30735 fis, clone FEBRA2000228 Mapping Information D5S1620E Sequence Map: Chr 5|HuRef Map Viewer   Position: 152276092-152276236 (bp)   D5S1620E Sequence Map: Chr 5|Celera Map Viewer   Position: 153214082-153214226 (bp)   D5S1620E Sequence Map: Chr 5 Map Viewer   Position: 157120068-157120212 (bp)   Cda0if11 NCBI RH Map: Chr 5 Map Viewer   Position: 933.7 (cR)   Lod score: 3.51   Cda0if11 GeneMap99-GB4 Map: Chr 5 Map Viewer   Position: 594.68 (cR3000)   Lod score: 1.76   Reference Interval: D5S2049-D5S1955 Electronic PCR results mRNA (2) AK023159.1 2634 .. 2778 (145 bp)   AK055297.1 3152 .. 3296 (145 bp)     Genomic (5 of 8)[Show All Hits] AC026407.4 87092 .. 87236 (145 bp)   CH003452.1 154450650 .. 154450794 (145 bp)   CH003500.1 162396491 .. 162396635 (145 bp)   CH471062.2 30842098 .. 30842242 (145 bp)   CM000256.1 153214082 .. 153214226 (145 bp)     ESTs (5 of 35)[Show All Hits] Z39959.1 86 .. 229 (144 bp)   F01929.1 84 .. 228 (145 bp)   F01930.1 84 .. 228 (145 bp)   F03148.1 86 .. 230 (145 bp)   R39070.1 94 .. 238 (145 bp)     Whole Genome Shotgun sequences (4) AADD01064926.1 16810 .. 16954 (145 bp)   AADC01056196.1 68906 .. 69050 (145 bp)   AADB02009635.1 19717 .. 19861 (145 bp)   ABBA01044264.1 19676 .. 19820 (145 bp)        Pan troglodytes Name: D5S1620E Polymorphism info:   Cross References Gene GeneID: 736032   Symbol: LSM11   Description: LSM11, U7 small nuclear RNA associated   Position:   Mapping Information D5S1620E Sequence Map: Chr 5 Map Viewer   Position: 159794189-159794333 (bp) Electronic PCR results RefSeq mRNA (1) XM_001138531.1 6305 .. 6449 (145 bp)     Genomic (1) CM000319.1 159794189 .. 159794333 (145 bp)     Whole Genome Shotgun sequences (2) AADA01078901.1 6982 .. 7126 (145 bp)   AACZ02065537.1 12215 .. 12359 (145 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement