PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:22998 Links RH16275 Homo sapiens chromosome 1, loci RORC and LINGO4 Macaca mulatta chromosome 1, loci LOC717052 and LOC711472 Pan troglodytes chromosome 1, loci LINGO4 and RORC Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CAAGAGAGGTTCTGGGCAAG Reverse primer: CTGCTCTTGTTGTGGAGAAGG PCR product size: 139 (bp), Homo sapiens    Homo sapiens Name: RH16275 Also known as: stSG8487 Polymorphism info:   Cross References Gene GeneID: 339398   Symbol: LINGO4   Description: leucine rich repeat and Ig domain containing 4   Position: 1q21.3 Gene GeneID: 6097   Symbol: RORC   Description: RAR-related orphan receptor C   Position: 1q21 UniGene Hs.256022 RAR-related orphan receptor C Mapping Information RH16275 Sequence Map: Chr 1|HuRef Map Viewer   Position: 123155683-123155821 (bp)   RH16275 Sequence Map: Chr 1|Celera Map Viewer   Position: 124893398-124893536 (bp)   RH16275 Sequence Map: Chr 1 Map Viewer   Position: 150045339-150045477 (bp)   stSG8487 NCBI RH Map: Chr 1 Map Viewer   Position: 1354.1 (cR)   Lod score: 3.06   stSG8487 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 552.04 (cR3000)   Lod score: 2.14   Reference Interval: D1S514-D1S2635 Electronic PCR results RefSeq mRNA (2) NM_005060.3 2760 .. 2898 (139 bp)   NM_001001523.1 2730 .. 2868 (139 bp)     mRNA (1) AF075096.1 349 .. 486 (138 bp)     Genomic (5 of 9)[Show All Hits] G25302.1 122 .. 260 (139 bp)   G27943.1 122 .. 260 (139 bp)   AL589765.19 128614 .. 128752 (139 bp)   CH003448.1 124712032 .. 124712171 (140 bp)   CH003496.1 127893902 .. 127894040 (139 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC068971.2 119939 .. 120077 (139 bp)     ESTs (5 of 24)[Show All Hits] H59278.1 130 .. 269 (140 bp)   H66996.1 122 .. 260 (139 bp)   AA179004.1 168 .. 305 (138 bp)   AA179256.1 36 .. 176 (141 bp)   AA286679.1 167 .. 305 (139 bp)     Whole Genome Shotgun sequences (4) AADD01008576.1 12340 .. 12479 (140 bp)   AADC01007217.1 24005 .. 24143 (139 bp)   AADB02000925.1 460362 .. 460500 (139 bp)   ABBA01049405.1 47885 .. 48023 (139 bp)        Macaca mulatta Name: RH16275 Polymorphism info:   Cross References Gene GeneID: 711472   Symbol: LOC711472   Description: similar to leucine rich repeat neuronal 6D   Position:   Gene GeneID: 717052   Symbol: LOC717052   Description: similar to RAR-related orphan receptor C isoform a   Position:   UniGene Mmu.5933 Similar to RAR-related orphan receptor C isoform a Mapping Information RH16275 Sequence Map: Chr 1 Map Viewer   Position: 130254703-130254841 (bp)    Pan troglodytes Name: RH16275 Polymorphism info:   Cross References Gene GeneID: 457303   Symbol: RORC   Description: RAR-related orphan receptor C   Position:   Gene GeneID: 469488   Symbol: LINGO4   Description: leucine rich repeat and Ig domain containing 4   Position:   Mapping Information RH16275 Sequence Map: Chr 1 Map Viewer   Position: 130882178-130882316 (bp) Electronic PCR results RefSeq mRNA (1) XR_025226.1 3099 .. 3237 (139 bp)     Genomic (1) CM000314.1 130882178 .. 130882316 (139 bp)     Whole Genome Shotgun sequences (2) AADA01120638.1 13511 .. 13649 (139 bp)   AACZ02009235.1 2375 .. 2513 (139 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement