ncbi logo
UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:22161 Links
D5S2379
Homo sapiens chromosome 5, loci SEPP1 and CCDC152
Macaca mulatta chromosome 6, loci LOC698917 and LOC698116

Found by e-PCR in sequences from Homo sapiens.

Primer InformationHelp

Forward primer:CAAACCATATTTTTTATGATGGAGC
Reverse primer:CATGTCTTTGTTGTTCTTCCTCC
PCR product size:182 (bp), Homo sapiens
GenBank Accession:G11197 Z11793

   Homo sapiens
Name: D5S2379
Also known as: GDB:675305 GDB:675721 SHGC-10827
Polymorphism info:  

Cross References Help
Gene GeneID:100129792
 Symbol:CCDC152
 Description:coiled-coil domain containing 152
 Position:5p12
Gene GeneID:6414
 Symbol:SEPP1
 Description:selenoprotein P, plasma, 1
 Position:5q31
UniGeneHs.275775 Selenoprotein P, plasma, 1
 Hs.702305 Selenoprotein P, plasma, 1

Mapping InformationHelp
D5S2379 Sequence Map: Chr 5|Celera Map Viewer
  Position: 42690002-42690182 (bp)
 
D5S2379 Sequence Map: Chr 5|HuRef Map Viewer
  Position: 42751889-42752069 (bp)
 
D5S2379 Sequence Map: Chr 5 Map Viewer
  Position: 42836225-42836405 (bp)
 
SHGC-10827 NCBI RH Map: Chr 5 Map Viewer
  Position: 178.9 (cR)
  Lod score: 1.62
 
SHGC-10827 TNG Map: Chr 5 Map Viewer
  Position: 21428 (cR50000)
  Lod score: 8.7
  Reference Interval: 59
 
SHGC-10827 Stanford-G3 Map: Chr 5 Map Viewer
  Position: 1702 (cR10000)
  Lod score: F
  Reference Interval: 10
 
SHGC-10827 GeneMap99-G3 Map: Chr 5 Map Viewer
  Position: 1697 (cR10000)
  Lod score: F
  Reference Interval: D5S634-D5S628

Electronic PCR results Help
RefSeq mRNA (5 of 6)[Show All Hits]
NM_005410.2 1420 .. 1600 (181 bp)  
NM_001085486.1 1449 .. 1629 (181 bp)  
NM_001093726.1 1508 .. 1688 (181 bp)  
XM_001717416.1 1650 .. 1830 (181 bp)  
XM_001714967.1 1650 .. 1830 (181 bp)  
 
mRNA (5 of 12)[Show All Hits]
Z11793.1 1356 .. 1537 (182 bp)  
BC005244.1 1390 .. 1570 (181 bp)  
BC015875.1 1394 .. 1574 (181 bp)  
AL833145.1 1392 .. 1572 (181 bp)  
AK094640.1 1452 .. 1632 (181 bp)  
 
Genomic (5 of 11)[Show All Hits]
G11197.1 174 .. 355 (182 bp)  
AC008945.6 105078 .. 105258 (181 bp)  
AC093260.2 145600 .. 145780 (181 bp)  
AC067967.3 10259 .. 10439 (181 bp)  
CH003452.1 42519440 .. 42519620 (181 bp)  
 
ESTs (5 of 103)[Show All Hits]
R31743.1 49 .. 228 (180 bp)  
AA203292.1 290 .. 470 (181 bp)  
AA446653.1 248 .. 428 (181 bp)  
AA776459.1 244 .. 424 (181 bp)  
AA843453.1 242 .. 422 (181 bp)  
 
Whole Genome Shotgun sequences (4)
AADD01057731.1 8635 .. 8815 (181 bp)  
AADC01050503.1 89869 .. 90049 (181 bp)  
AADB02008695.1 153107 .. 153287 (181 bp)  
ABBA01024242.1 47424 .. 47604 (181 bp)  
 

   Macaca fascicularis
 
Polymorphism info:  

Cross References Help
UniGeneMfa.8191 Macaca fascicularis brain cDNA, clone: QtrA-12102, similar to human selenopr...


   Macaca mulatta
Name: D5S2379
Polymorphism info:  

Cross References Help
Gene GeneID:698116
 Symbol:LOC698116
 Description:hypothetical protein LOC698116
 Position: 
Gene GeneID:698917
 Symbol:LOC698917
 Description:similar to selenoprotein P precursor
 Position: 
UniGeneMmu.2133 Similar to selenoprotein P precursor

Mapping InformationHelp
D5S2379 Sequence Map: Chr 6 Map Viewer
  Position: 42711159-42711339 (bp)

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement