PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:40881 Links SHGC-12780 Homo sapiens chromosome 8, locus NRG1 Macaca mulatta chromosome 8, locus NRG1 Pan troglodytes chromosome 8, locus NRG1 Sus scrofa chromosome 15, locus LOC100154857 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Sus scrofa. Primer Information Forward primer: CTTTCTTGTTGCTGCATCTCC Reverse primer: CACCCTTTTCAGGATGTGGT PCR product size: 343 (bp), Homo sapiens GenBank Accession: U02327    Homo sapiens Name: SHGC-12780 Also known as: WI-7731 Polymorphism info:   Cross References Gene GeneID: 3084   Symbol: NRG1   Description: neuregulin 1   Position: 8p12 UniGene Hs.453951 Neuregulin 1 Mapping Information SHGC-12780 Sequence Map: Chr 8|HuRef Map Viewer   Position: 31145711-31146053 (bp)   SHGC-12780 Sequence Map: Chr 8|Celera Map Viewer   Position: 31559021-31559363 (bp)   SHGC-12780 Sequence Map: Chr 8 Map Viewer   Position: 32719850-32720192 (bp)   SHGC-12780 NCBI RH Map: Chr 8 Map Viewer   Position: 456.8 (cR)   Lod score: 3.34   SHGC-12780 Stanford-G3 Map: Chr 8 Map Viewer   Position: 1479 (cR10000)   Lod score: F   Reference Interval: 21   SHGC-12780 GeneMap99-G3 Map: Chr 8 Map Viewer   Position: 1569 (cR10000)   Lod score: F   Reference Interval: D8S1820-D8S505 Electronic PCR results RefSeq mRNA (4) NM_013958.2 1240 .. 1582 (343 bp)   NM_013959.2 1621 .. 1963 (343 bp)   NM_013961.2 1240 .. 1582 (343 bp)   NM_013962.2 1524 .. 1866 (343 bp)     mRNA (5 of 9)[Show All Hits] M94168.1 1240 .. 1582 (343 bp)   L12260.1 1552 .. 1894 (343 bp)   U02327.1 452 .. 794 (343 bp)   L41827.1 1413 .. 1755 (343 bp)   AF009227.1 2662 .. 3004 (343 bp)     Genomic (5 of 10)[Show All Hits] AC103675.2 96325 .. 96667 (343 bp)   AC113209.4 189077 .. 189419 (343 bp)   BK000383.1 1347766 .. 1348108 (343 bp)   CH003455.1 31269799 .. 31270141 (343 bp)   CH003503.1 41116384 .. 41116726 (343 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AF128834.4 132564 .. 132906 (343 bp)     ESTs (5 of 7)[Show All Hits] AI478167.1 93 .. 435 (343 bp)   AI634664.1 93 .. 435 (343 bp)   BF196018.1 89 .. 431 (343 bp)   BF431949.1 99 .. 441 (343 bp)   BG193441.1 123 .. 463 (341 bp)     Whole Genome Shotgun sequences (4) AADD01090058.1 4980 .. 5322 (343 bp)   AADC01074894.1 97493 .. 97835 (343 bp)   AADB02011213.1 205705 .. 206047 (343 bp)   ABBA01023619.1 223034 .. 223376 (343 bp)        Macaca mulatta Name: SHGC-12780 Polymorphism info:   Cross References Gene GeneID: 696275   Symbol: NRG1   Description: neuregulin 1   Position:   Mapping Information SHGC-12780 Sequence Map: Chr 8 Map Viewer   Position: 33029667-33030008 (bp)    Pan troglodytes Name: SHGC-12780 Polymorphism info:   Cross References Gene GeneID: 464102   Symbol: NRG1   Description: neuregulin 1   Position:   Mapping Information SHGC-12780 Sequence Map: Chr 8 Map Viewer   Position: 29396945-29397285 (bp) Electronic PCR results Genomic (1) CM000322.2 29396945 .. 29397285 (341 bp)     Whole Genome Shotgun sequences (2) AADA01035905.1 769 .. 1109 (341 bp)   AACZ02093701.1 4642 .. 4982 (341 bp)        Sus scrofa Name: SHGC-12780 Polymorphism info:   Cross References Gene GeneID: 100154857   Symbol: LOC100154857   Description: similar to neuregulin 1   Position:   UniGene Ssc.38177 Transcribed locus, strongly similar to XP_991396.1 PREDICTED: similar to neu... Mapping Information SHGC-12780 Sequence Map: Chr 15 Map Viewer   Position: 16442132-16442470 (bp) Electronic PCR results Working Draft phase 1 (from GenBank HTGS division) (2) CU607090.1 87665 .. 88003 (339 bp)   CU469303.2 125640 .. 125978 (339 bp)     ESTs (5) DN114685.1 101 .. 439 (339 bp)   EW569420.1 185 .. 518 (334 bp)   EW572382.1 117 .. 450 (334 bp)   EW572382.2 119 .. 457 (339 bp)   EW569420.2 188 .. 526 (339 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement