PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:23586 Links RH78705 Homo sapiens chromosome 7, loci BET1, LOC100134599, and LOC100128876 Pan troglodytes chromosome 7, locus LOC463541 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CAATGCCTGAGTTTCTTGCA Reverse primer: ATGAATTCTCTTGACTTGGCTT PCR product size: 142 (bp), Homo sapiens    Homo sapiens Name: RH78705 Also known as: stSG42265 Polymorphism info:   Cross References Gene GeneID: 100128876   Symbol: LOC100128876   Description: hypothetical protein LOC100128876   Position: 7q21.3 Gene GeneID: 100134599   Symbol: LOC100134599   Description: hypothetical protein LOC100134599   Position:   Gene GeneID: 10282   Symbol: BET1   Description: blocked early in transport 1 homolog (S. cerevisiae)   Position: 7q21.1-q22 UniGene Hs.489132 Blocked early in transport 1 homolog (S. cerevisiae)   Hs.653635 Transcribed locus Mapping Information RH78705 Sequence Map: Chr 7|HuRef Map Viewer   Position: 88230264-88230405 (bp)   RH78705 Sequence Map: Chr 7|Celera Map Viewer   Position: 88321005-88321146 (bp)   RH78705 Sequence Map: Chr 7|CRA_TCAGchr7v2 Map Viewer   Position: 92951906-92952047 (bp)   RH78705 Sequence Map: Chr 7 Map Viewer   Position: 93460672-93460813 (bp)   stSG42265 NCBI RH Map: Chr 7 Map Viewer   Position: 1039 (cR)   Lod score: 1.85   stSG42265 GeneMap99-GB4 Map: Chr 7 Map Viewer   Position: 496.29 (cR3000)   Lod score: 3.00   Reference Interval: D7S657-D7S527 Electronic PCR results RefSeq mRNA (1) NM_005868.4 1184 .. 1325 (142 bp)     mRNA (2) BC000899.1 1077 .. 1218 (142 bp)   BC012595.1 730 .. 871 (142 bp)     Genomic (5 of 11)[Show All Hits] G30358.1 166 .. 307 (142 bp)   AC006378.2 60325 .. 60466 (142 bp)   BL000002.1 93162571 .. 93162712 (142 bp)   CH003454.1 88799478 .. 88799619 (142 bp)   CH003502.1 83954265 .. 83954406 (142 bp)     ESTs (5 of 73)[Show All Hits] H54289.1 166 .. 307 (142 bp)   N26817.1 183 .. 324 (142 bp)   N29507.1 175 .. 316 (142 bp)   N99139.1 171 .. 310 (140 bp)   W37912.1 108 .. 249 (142 bp)     Whole Genome Shotgun sequences (5) AADD01083640.1 2245 .. 2386 (142 bp)   AADC01069920.1 325114 .. 325255 (142 bp)   AACC02000014.1 664727 .. 664868 (142 bp)   AADB02010684.1 763064 .. 763205 (142 bp)   ABBA01045786.1 183197 .. 183338 (142 bp)        Pan troglodytes Name: RH78705 Polymorphism info:   Cross References Gene GeneID: 463541   Symbol: LOC463541   Description: hypothetical LOC463541   Position:   Mapping Information RH78705 Sequence Map: Chr 7 Map Viewer   Position: 93637544-93637685 (bp) Electronic PCR results Genomic (3) AC146007.2 153616 .. 153757 (142 bp)   AC147324.3 50189 .. 50330 (142 bp)   CM000321.1 93637544 .. 93637685 (142 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC093443.2 108183 .. 108324 (142 bp)     Whole Genome Shotgun sequences (2) AADA01075229.1 5346 .. 5487 (142 bp)   AACZ02085721.1 6697 .. 6838 (142 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement