PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:394882 Links REN70082 Homo sapiens chromosome 5, locus SLC22A5 Pan troglodytes chromosome 5, locus LOC462049 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GAAAAGGCCCCTAATAAGGCTAGA Reverse primer: TCTTAAGAGCTCACACATCAGTGC PCR product size: 264 (bp), Homo sapiens    Homo sapiens Name: REN70082 Polymorphism info:   Cross References Gene GeneID: 6584   Symbol: SLC22A5   Description: solute carrier family 22 (organic cation/carnitine transporter), member 5   Position: 5q31 UniGene Hs.705425 Solute carrier family 22 (organic cation transporter), member 5 Mapping Information REN70082 Sequence Map: Chr 5|HuRef Map Viewer   Position: 126922562-126922825 (bp)   REN70082 Sequence Map: Chr 5|Celera Map Viewer   Position: 127860392-127860655 (bp)   REN70082 Sequence Map: Chr 5 Map Viewer   Position: 131758215-131758478 (bp) Electronic PCR results RefSeq mRNA (1) NM_003060.3 2290 .. 2553 (264 bp)     mRNA (4) AF057164.1 2246 .. 2509 (264 bp)   BC012325.1 2196 .. 2459 (264 bp)   AK128610.1 2704 .. 2967 (264 bp)   AB209484.1 9449 .. 9712 (264 bp)     Genomic (5 of 10)[Show All Hits] AC004628.1 6780 .. 7043 (264 bp)   AB016625.1 24882 .. 25145 (264 bp)   AC118464.2 36670 .. 36933 (264 bp)   AC116366.2 6181 .. 6444 (264 bp)   CH003452.1 129125306 .. 129125569 (264 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC023861.3 112212 .. 112475 (264 bp)     ESTs (2) BM725111.1 104 .. 271 (168 bp)   BQ631485.1 70 .. 333 (264 bp)     Whole Genome Shotgun sequences (4) AADD01063355.1 24020 .. 24283 (264 bp)   AADC01055192.1 38187 .. 38450 (264 bp)   AADB02009472.1 614280 .. 614543 (264 bp)   ABBA01068808.1 15797 .. 16060 (264 bp)        Pan troglodytes Name: REN70082 Polymorphism info:   Cross References Gene GeneID: 462049   Symbol: LOC462049   Description: similar to OCTN2   Position:   Mapping Information REN70082 Sequence Map: Chr 5 Map Viewer   Position: 134017799-134018061 (bp) Electronic PCR results RefSeq mRNA (1) XR_024819.1 2366 .. 2628 (263 bp)     Genomic (3) AC156804.2 2596 .. 2858 (263 bp)   AC157496.3 211302 .. 211564 (263 bp)   CM000319.1 134017799 .. 134018061 (263 bp)     Whole Genome Shotgun sequences (2) AADA01045718.1 26653 .. 26915 (263 bp)   AACZ02064044.1 27059 .. 27321 (263 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement