Join Evaluation Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <100 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Curator Links

Add/Update certificate

Alignment for AL645524.8 and AL596246.10

AL645524.8 Mouse DNA sequence from clone RP23-35D7 on chromosome 11 Contains part of the gene for a novel protein and a basic leucine zipper and W2 domains 1 (Bzw1) pseudogene, complete sequence [htgs_phase3]

Length: 210,163 bp

AL596246.10 Mouse DNA sequence from clone RP23-186E14 on chromosome 11 Contains the 3' end of a gene for a novel protein, an RNA U transporter 1 (Rnut1) pseudogene, the Cyb561 gene for cytochrome b-561, the 3' end of a novel transcript and the 5' end of the Ace gene for angiotensin converting enzyme, complete sequence [htgs_phase3]

Length: 144,136 bp

Alignment Summary

Join evaluation: green

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 2542
Total Length: 2000
Aligned Length: 2000
Percent Identity: 100
Number of Gaps: 0
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Alignment 1 of 1

 Mismatches = 0, Gaps = 0, Length = 2000
 Percent identity = 100%
 Score = 3965 bits (2000), Expect = 0
  2 BAC and 3 Fosmid bridging clones.
  2 BAC and 3 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL645524.8  >208164  gctccagaaagcccctcccttacctatcagtgtggatttcttcatctgagcattttatat 208223 
AL596246.10 >1       ............................................................ 60     

AL645524.8  >208224  aaatagaaacatacttaaaattttgggaactgatgtgatatcatctgtgttgtagcatgt 208283 
AL596246.10 >61      ............................................................ 120    

AL645524.8  >208284  gtgtatctcattttctttcatcatcaaatagcagtccattgtatggagatagcacacttc 208343 
AL596246.10 >121     ............................................................ 180    

AL645524.8  >208344  atccattcgttgtgatggacatctgacttgcttttactttctgttctaagtcatgcttct 208403 
AL596246.10 >181     ............................................................ 240    

AL645524.8  >208404  ctggacagggatatgcaagtttctatttagacacgtgtgtttgtttgtttgtttgtttgt 208463 
AL596246.10 >241     ............................................................ 300    

AL645524.8  >208464  ttgttttttatttcacttgagttatatggtcagaaatggaattgctaggttatagaacaa 208523 
AL596246.10 >301     ............................................................ 360    

AL645524.8  >208524  aatagaatttaatattcctttagtctatagagcagtggttctcaacctggggatcatgac 208583 
AL596246.10 >361     ............................................................ 420    

AL645524.8  >208584  ccctttgagggtcaaacagaactttcacagggatcacctaagacaatcagaaaactgatg 208643 
AL596246.10 >421     ............................................................ 480    

AL645524.8  >208644  ttttctttttttttaagtttatttatttattatatctaagtacactgtagctgtcttcag 208703 
AL596246.10 >481     ............................................................ 540    

AL645524.8  >208704  acactccagaagagggcatcagatttcgttatggatggttgtgagccaccatgtggttgc 208763 
AL596246.10 >541     ............................................................ 600    

AL645524.8  >208764  tgggatttgaacttgggacctttggaagagcagtcggtgctcttaaccactgagccatct 208823 
AL596246.10 >601     ............................................................ 660    

AL645524.8  >208824  cgccagccccaaaactgatgttttcattaggattcataataacagtagcaaaattagagt 208883 
AL596246.10 >661     ............................................................ 720    

AL645524.8  >208884  tatgaagtaacaacaaaaataattttatggctggtggtcaccacaacatgaggaactgta 208943 
AL596246.10 >721     ............................................................ 780    

AL645524.8  >208944  ttaaatggttgcagcattaggaagattgagacccactggtctagagctttatgatcttct 209003 
AL596246.10 >781     ............................................................ 840    

AL645524.8  >209004  gattaaacatcgcatctttttaattcagatgtggacgccaacagagagctaccactcacc 209063 
AL596246.10 >841     ............................................................ 900    

AL645524.8  >209064  caagcaccttcagctcactcatctattaccagtggaagctgcccaggaactccagaaatg 209123 
AL596246.10 >901     ............................................................ 960    

AL645524.8  >209124  cgcaggcggcaagaggaagccatgcgaagacttgcctcacaggtacaataggattcccaa 209183 
AL596246.10 >961     ............................................................ 1020   

AL645524.8  >209184  gttgggggcctgcgagtttcattttagcaccaaagcaaagatagggagactcttagcaaa 209243 
AL596246.10 >1021    ............................................................ 1080   

AL645524.8  >209244  gagaacaaaaatgtgtaaaggaattcatgaaaacatgaagaaaagtttctctttttactt 209303 
AL596246.10 >1081    ............................................................ 1140   

AL645524.8  >209304  tttttgggttggtggtggtggtggtggtgtactcatttaaaaaaaaaaatactctgatgg 209363 
AL596246.10 >1141    ............................................................ 1200   

AL645524.8  >209364  gattagaacctccaagacttagaagcaaagtcttccagtgaataaatgaaggccacagat 209423 
AL596246.10 >1201    ............................................................ 1260   

AL645524.8  >209424  agtttagccaaagccagggtataaaaaatcaataacattattactgactcagagctcttc 209483 
AL596246.10 >1261    ............................................................ 1320   

AL645524.8  >209484  ctcctatatcatattgtccataatgtttttatttaaatttcctgtcattttcaaaataac 209543 
AL596246.10 >1321    ............................................................ 1380   

AL645524.8  >209544  atatgtacataggaaagcaaatagtgttcagaacaaacagttgacttctttacccaaccc 209603 
AL596246.10 >1381    ............................................................ 1440   

AL645524.8  >209604  atcacccccaagcagctgtatatctccaggcccttttgttaagagttcaccaacattatc 209663 
AL596246.10 >1441    ............................................................ 1500   

AL645524.8  >209664  ttgtaacctttcagtaaaagaattttcgtgtgactatcatagttttaatatcaaatagct 209723 
AL596246.10 >1501    ............................................................ 1560   

AL645524.8  >209724  ctttctttttctgcagttactcccttgcttatagagctagcagggccagagcaagaggga 209783 
AL596246.10 >1561    ............................................................ 1620   

AL645524.8  >209784  gaaaggaaagaggggggaaaagttaaatattgttcaagttggaaagtatatttacttaaa 209843 
AL596246.10 >1621    ............................................................ 1680   

AL645524.8  >209844  aaatatttttaaaattttggcatcctaagagcaacttataaacacattttcatgtgaggg 209903 
AL596246.10 >1681    ............................................................ 1740   

AL645524.8  >209904  tgcaccatgtttaatttatgctaacctttgtataagaaatggctcctggttgacaacatg 209963 
AL596246.10 >1741    ............................................................ 1800   

AL645524.8  >209964  agtattatcctcattacaattatgacacattacagtttggccatagaagcttgtgccatg 210023 
AL596246.10 >1801    ............................................................ 1860   

AL645524.8  >210024  ggagcacagagcagaagccagcagtctagcttctcaccctaccaaaccagtgagtgcaca 210083 
AL596246.10 >1861    ............................................................ 1920   

AL645524.8  >210084  tctgactttcaaatgagaactcaagtcagtatggttttgtttttattttatatatcaaga 210143 
AL596246.10 >1921    ............................................................ 1980   

AL645524.8  >210144  gcctcttggtttgagaattc 210163 
AL596246.10 >1981    .................... 2000

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time
A	210163	2001	+	+	chenhc	Taxid 10090 chrom 11 Reference assembly	2008-11-20 16:57:05.643

Events

Id	Type	Date	Whodid	Comment
4888	ImportOldDb	09/02/2005 14:51:00	f_old_db
4889	ReSetShortOvlp	09/04/2008 10:31:48	dbo
174865	CreateSwitchPt	11/20/2008 16:57:05	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-105E2	AL645524.8	99.63%	pos 93592 (R-)
C3H-105G3				AL596246.10	99.18%	pos 97066 (F+)
C3H-105G4				AL596246.10	99.24%	pos 97219 (F+)
C3H-105H3				AL596246.10	99.11%	pos 97240 (F+)
C3H-118I9	AL596246.10	99.01%	pos 107020 (R-)	AL645524.8	99.42%	pos 188739 (F+)
C3H-124F10	AL645524.8	99.45%	pos 169445 (R+)	AL596246.10	99.54%	pos 106911 (F-)
C3H-128F6	AL645524.8	100%	pos 174996 (R-)	AL645524.8	99.35%	pos 48339 (F+)
C3H-243N3				AL645524.8	99.06%	pos 5309 (F+)
C3H-24M2	AL596246.10	99.37%	pos 38731 (R+)
C3H-49P9	AL645524.8	99.42%	pos 32619 (R-)
C3H-61P12	AL645524.8	99.37%	pos 195172 (R-)
C3H-61P19	AL645524.8	99.87%	pos 48166 (R-)
CH29-170M21	AL645524.8	99.18%	pos 199420 (R+)
CH29-191J10				AL645524.8	99.09%	pos 197856 (F+)
CH29-36L19				AL596246.10	99.34%	pos 99835 (F+)
CH29-499M22	AL645524.8	99.88%	pos 199329 (R-)
CH29-515E22				AL645524.8	99.33%	pos 108145 (F+)
CH29-593N15	AL645524.8	99.86%	pos 207061 (R-)	AL645524.8	99.75%	pos 13771 (F+)
CH29-70J22				AL596246.10	99.53%	pos 91690 (F+)
RP23-35D7				AL645524.8	99.85%	pos 210131 (F-)
RP23-35D7				AL596246.10	99.85%	pos 1968 (F-)
RP24-177M4				AL596246.10	100%	pos 65932 (F+)
RP24-270K16				AL645524.8	99.79%	pos 131562 (F-)
RP24-331I10	AL645524.8	99.52%	pos 162655 (R-)	AL645524.8	99.28%	pos 37220 (F+)
RP24-67B17	AL645524.8	99.79%	pos 170081 (R-)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-1008C9				AL596246.10	100%	pos 34515 (F-)
WI1-1058M13				AL596246.10	100%	pos 127933 (F+)
WI1-1083H2				AL596246.10	100%	pos 127891 (F+)
WI1-1121G14				AL596246.10	99.86%	pos 137473 (F+)
WI1-1150B22				AL596246.10	99.63%	pos 87263 (F-)
WI1-1159M1	AL596246.10	100%	pos 78076 (R-)
WI1-1179M13				AL596246.10	99.8%	pos 124405 (F+)
WI1-1188K8	AL645524.8	100%	pos 164055 (R-)	AL645524.8	99.83%	pos 120764 (F+)
WI1-1215L5				AL596246.10	100%	pos 142510 (F-)
WI1-1244G2	AL596246.10	100%	pos 71995 (R-)	AL596246.10	99.78%	pos 31202 (F+)
WI1-1252M20				AL596246.10	100%	pos 109288 (F+)
WI1-131C6	AL596246.10	99.71%	pos 53248 (R+)	AL596246.10	100%	pos 94097 (F-)
WI1-134D8	AL645524.8	100%	pos 60399 (R-)	AL645524.8	99.85%	pos 19237 (F+)
WI1-134F20	AL645524.8	100%	pos 118787 (R+)	AL645524.8	99.86%	pos 162678 (F-)
WI1-1393N4	AL645524.8	100%	pos 134067 (R-)	AL645524.8	99.82%	pos 94277 (F+)
WI1-1399B5				AL596246.10	100%	pos 106921 (F+)
WI1-146C8	AL596246.10	100%	pos 103270 (R-)	AL596246.10	100%	pos 62369 (F+)
WI1-1610L9	AL596246.10	100%	pos 68438 (R+)	AL596246.10	99.69%	pos 107660 (F-)
WI1-163I8	AL596246.10	100%	pos 107746 (R-)	AL596246.10	99.84%	pos 64110 (F+)
WI1-1651D11	AL596246.10	100%	pos 77063 (R+)	AL596246.10	100%	pos 115549 (F-)
WI1-1665B8	AL596246.10	99.82%	pos 40548 (R+)	AL596246.10	100%	pos 78668 (F-)
WI1-1666J22	AL596246.10	100%	pos 40548 (R+)	AL596246.10	100%	pos 78669 (F-)
WI1-1758D7	AL645524.8	99.84%	pos 86307 (R-)	AL645524.8	100%	pos 48687 (F+)
WI1-1865B20				AL596246.10	100%	pos 109271 (F+)
WI1-1972I20	AL596246.10	99.75%	pos 72041 (R-)	AL596246.10	99.84%	pos 33422 (F+)
WI1-1985L10	AL645524.8	99.65%	pos 202753 (R+)	AL596246.10	99.49%	pos 34276 (F-)
WI1-2261O6	AL645524.8	100%	pos 193195 (R+)	AL596246.10	99.83%	pos 21539 (F-)
WI1-2268D22	AL596246.10	100%	pos 24796 (R-)	AL645524.8	99.79%	pos 193705 (F+)
WI1-2277M15	AL645524.8	100%	pos 19687 (R-)
WI1-2336J21	AL596246.10	99.26%	pos 33803 (R-)
WI1-233B4	AL596246.10	100%	pos 95458 (R-)
WI1-2401D3	AL645524.8	100%	pos 161980 (R+)	AL645524.8	99.82%	pos 205396 (F-)
WI1-2407P17	AL645524.8	100%	pos 55334 (R+)	AL645524.8	99.72%	pos 93250 (F-)
WI1-2416I17	AL645524.8	99.32%	pos 126750 (R+)	AL645524.8	100%	pos 167109 (F-)
WI1-2442L1	AL596246.10	99.77%	pos 143588 (R+)
WI1-2579J8				AL645524.8	100%	pos 157068 (F+)
WI1-2644H13	AL645524.8	99.74%	pos 92891 (R-)	AL645524.8	99.85%	pos 47976 (F+)
WI1-2667O16	AL596246.10	100%	pos 67875 (R+)	AL596246.10	100%	pos 110650 (F-)
WI1-2826P11	AL645524.8	100%	pos 49871 (R+)	AL645524.8	99.72%	pos 93355 (F-)
WI1-2837L16	AL596246.10	99.67%	pos 123397 (R+)
WI1-2863A22	AL596246.10	100%	pos 96155 (R+)	AL596246.10	100%	pos 136090 (F-)
WI1-2870A4	AL645524.8	99.82%	pos 43605 (R+)
WI1-2910P16	AL596246.10	99.71%	pos 106902 (R-)
WI1-358C19				AL596246.10	100%	pos 126173 (F+)
WI1-508F8	AL645524.8	100%	pos 143502 (R-)	AL645524.8	99.17%	pos 103951 (F+)
WI1-627D20				AL645524.8	100%	pos 115517 (F+)
WI1-650K24	AL645524.8	100%	pos 94096 (R-)
WI1-696L20				AL596246.10	100%	pos 40470 (F+)
WI1-707A8	AL645524.8	100%	pos 133364 (R-)	AL645524.8	99.33%	pos 92894 (F+)
WI1-799A7	AL596246.10	100%	pos 30014 (R+)	AL596246.10	99.84%	pos 69759 (F-)

NCBI

Join Evaluation Legend

Curator Links

Alignment for AL645524.8 and AL596246.10

Alignment Summary

Alignment 1 of 1