ncbi logo
UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:78576 Links
D14S896
Homo sapiens chromosome 14, locus GNG2
Macaca mulatta chromosome 7
Pan troglodytes chromosome 14, locus GNG2

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:TTCCTTAAAATGCTCCCTAG
Reverse primer:CCAGACGATTTCCACTATTC
PCR product size:123-124 (bp), Homo sapiens

   Homo sapiens
Name: D14S896
Also known as: 2492 BCD2491 GDB:596517
Polymorphism info:  

Cross References Help
Gene GeneID:54331
 Symbol:GNG2
 Description:guanine nucleotide binding protein (G protein), gamma 2
 Position:14q21
UniGeneHs.705393 Guanine nucleotide binding protein (G protein), gamma 2

Mapping InformationHelp
D14S896 Sequence Map: Chr 14|Celera Map Viewer
  Position: 32302539-32302662 (bp)
 
D14S896 Sequence Map: Chr 14|HuRef Map Viewer
  Position: 32596227-32596350 (bp)
 
D14S896 Sequence Map: Chr 14 Map Viewer
  Position: 51505296-51505419 (bp)
 
2492 NCBI RH Map: Chr 14 Map Viewer
  Position: 513.8 (cR)
  Lod score: 1.59
 
2492 GeneMap99-GB4 Map: Chr 14 Map Viewer
  Position: 119.09 (cR3000)
  Lod score: 3.00
  Reference Interval: D14S70-D14S281

Electronic PCR results Help
RefSeq mRNA (1)
NM_053064.3 2886 .. 3009 (124 bp)  
 
mRNA (4)
AK026424.1 1258 .. 1381 (124 bp)  
AK026425.1 1258 .. 1381 (124 bp)  
AK092371.1 2767 .. 2890 (124 bp)  
BC060856.1 2452 .. 2575 (124 bp)  
 
Genomic (5 of 8)[Show All Hits]
AL358333.4 51535 .. 51658 (124 bp)  
AL954800.2 32355584 .. 32355707 (124 bp)  
CH003461.1 32187907 .. 32188030 (124 bp)  
CH003509.1 32391604 .. 32391727 (124 bp)  
CH471078.2 32244661 .. 32244784 (124 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC025872.2 22450 .. 22573 (124 bp)  
 
ESTs (5 of 22)[Show All Hits]
Z39525.1 104 .. 227 (124 bp)  
F01428.1 104 .. 227 (124 bp)  
H25892.1 119 .. 242 (124 bp)  
AL038010.1 280 .. 403 (124 bp)  
AL038100.2 113 .. 236 (124 bp)  
 
Whole Genome Shotgun sequences (4)
AADD01138093.1 41247 .. 41370 (124 bp)  
AADC01117304.1 39167 .. 39290 (124 bp)  
AADB02016074.1 232802 .. 232925 (124 bp)  
ABBA01018161.1 39553 .. 39676 (124 bp)  
 

   Macaca fascicularis
 
Polymorphism info:  

Cross References Help
UniGeneMfa.9594 Macaca fascicularis brain cDNA, clone: QmoA-10367


   Macaca mulatta
Name: D14S896
Polymorphism info:  
Mapping InformationHelp
D14S896 Sequence Map: Chr 7 Map Viewer
  Position: 114987529-114987652 (bp)

   Pan troglodytes
Name: D14S896
Polymorphism info:  

Cross References Help
Gene GeneID:467457
 Symbol:GNG2
 Description:guanine nucleotide binding protein (G protein), gamma 2
 Position: 

Mapping InformationHelp
D14S896 Sequence Map: Chr 14 Map Viewer
  Position: 51193413-51193536 (bp)

Electronic PCR results Help
RefSeq mRNA (5)
XM_522854.2 2563 .. 2686 (124 bp)  
XM_001158267.1 2625 .. 2748 (124 bp)  
XM_001158222.1 2488 .. 2611 (124 bp)  
XM_001158320.1 2453 .. 2576 (124 bp)  
XM_001158380.1 3058 .. 3181 (124 bp)  
 
Genomic (1)
CM000328.1 51193413 .. 51193536 (124 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01357287.1 8795 .. 8918 (124 bp)  
AACZ02148666.1 7623 .. 7746 (124 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement