PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:380430 Links REN55630 Homo sapiens chromosome 11, locus SLC22A12 Macaca mulatta chromosome 14, locus LOC717530 Pan troglodytes chromosome 11, locus SLC22A12 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CCACACAGAGACTTGCACAGC Reverse primer: AAAGTTTAACCCGCGTTGAGG PCR product size: 257 (bp), Homo sapiens    Homo sapiens Name: REN55630 Polymorphism info:   Cross References Gene GeneID: 116085   Symbol: SLC22A12   Description: solute carrier family 22 (organic anion/urate transporter), member 12   Position: 11q13.1 UniGene Hs.174424 Solute carrier family 22 (organic anion/cation transporter), member 12 Mapping Information REN55630 Sequence Map: Chr 11|HuRef Map Viewer   Position: 60685831-60686087 (bp)   REN55630 Sequence Map: Chr 11|Celera Map Viewer   Position: 61684633-61684889 (bp)   REN55630 Sequence Map: Chr 11 Map Viewer   Position: 64114951-64115207 (bp) Electronic PCR results RefSeq mRNA (2) NM_144585.2 94 .. 350 (257 bp)   NM_153378.1 94 .. 350 (257 bp)     mRNA (1) AB050269.1 94 .. 350 (257 bp)     Genomic (5 of 12)[Show All Hits] AC012153.10 15828 .. 16084 (257 bp)   AC044790.4 126839 .. 127095 (257 bp)   AP006288.2 73811 .. 74067 (257 bp)   AP001092.5 33833 .. 34089 (257 bp)   BX647472.1 2945 .. 3201 (257 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AP000655.2 50426 .. 50682 (257 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC124000.1 50493 .. 50749 (257 bp)     Whole Genome Shotgun sequences (4) AADD01116324.1 3438 .. 3694 (257 bp)   AADC01099109.1 52737 .. 52993 (257 bp)   AADB02014111.1 285536 .. 285792 (257 bp)   ABBA01024151.1 7353 .. 7609 (257 bp)        Macaca mulatta Name: REN55630 Polymorphism info:   Cross References Gene GeneID: 717530   Symbol: LOC717530   Description: similar to urate anion exchanger 1 isoform a   Position:   Mapping Information REN55630 Sequence Map: Chr 14 Map Viewer   Position: 9867461-9867717 (bp)    Pan troglodytes Name: REN55630 Polymorphism info:   Cross References Gene GeneID: 743768   Symbol: SLC22A12   Description: solute carrier family 22 (organic anion/urate transporter), member 12   Position:   Mapping Information REN55630 Sequence Map: Chr 11 Map Viewer   Position: 63001034-63001290 (bp) Electronic PCR results RefSeq mRNA (2) XM_001165234.1 94 .. 350 (257 bp)   XM_001165263.1 94 .. 350 (257 bp)     Genomic (1) CM000325.1 63001034 .. 63001290 (257 bp)     Whole Genome Shotgun sequences (2) AADA01281911.1 468 .. 724 (257 bp)   AACZ02125255.1 2705 .. 2961 (257 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement