PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:58298 Links RH47426 Homo sapiens chromosome 10, locus BLOC1S2 Pan troglodytes chromosome 10, locus LOC744662 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GTGGCAATCGTCACCTCC Reverse primer: GATGGGCCCCTCTTGTTTAT PCR product size: 129 (bp), Homo sapiens    Homo sapiens Name: RH47426 Also known as: stSG27214 Polymorphism info:   Cross References Gene GeneID: 282991   Symbol: BLOC1S2   Description: biogenesis of lysosomal organelles complex-1, subunit 2   Position: 10q24.31 UniGene Hs.34906 Transcribed locus   Hs.702055 Biogenesis of lysosome-related organelles complex-1, subunit 2 Mapping Information RH47426 Sequence Map: Chr 10 Map Viewer   Position: 102024474-102024602 (bp)   RH47426 Sequence Map: Chr 10|HuRef Map Viewer   Position: 95663437-95663565 (bp)   RH47426 Sequence Map: Chr 10|Celera Map Viewer   Position: 95772447-95772575 (bp)   stSG27214 NCBI RH Map: Chr 10 Map Viewer   Position: 1089.7 (cR)   Lod score: 1.45   stSG27214 GeneMap99-GB4 Map: Chr 10 Map Viewer   Position: 467.38 (cR3000)   Lod score: 1.97   Reference Interval: D10S564-D10S603 Electronic PCR results RefSeq mRNA (2) NM_173809.2 1059 .. 1187 (129 bp)   NM_001001342.1 1125 .. 1253 (129 bp)     mRNA (2) AK054697.1 1125 .. 1253 (129 bp)   BC020494.1 960 .. 1088 (129 bp)     Genomic (5 of 9)[Show All Hits] G25476.1 27 .. 155 (129 bp)   G27901.1 27 .. 155 (129 bp)   AL138921.14 188829 .. 188957 (129 bp)   CH003457.1 95263613 .. 95263741 (129 bp)   CH003505.1 99199613 .. 99199741 (129 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC018783.3 149753 .. 149881 (129 bp)   AC026883.3 91830 .. 91958 (129 bp)     ESTs (5 of 75)[Show All Hits] D60459.1 27 .. 155 (129 bp)   D61354.1 27 .. 155 (129 bp)   H61191.1 15 .. 143 (129 bp)   H88737.1 6 .. 134 (129 bp)   H98192.1 30 .. 158 (129 bp)     Whole Genome Shotgun sequences (4) AADD01110368.1 7620 .. 7748 (129 bp)   AADC01093626.1 50798 .. 50926 (129 bp)   AADB02013266.1 381102 .. 381230 (129 bp)   ABBA01063229.1 6612 .. 6740 (129 bp)        Pan troglodytes Name: RH47426 Polymorphism info:   Cross References Gene GeneID: 744662   Symbol: LOC744662   Description: similar to Biogenesis of lysosome-related organelles complex-1, subunit 2   Position:   Mapping Information RH47426 Sequence Map: Chr 10 Map Viewer   Position: 100615163-100615291 (bp) Electronic PCR results RefSeq mRNA (1) XM_001149615.1 902 .. 1030 (129 bp)     Genomic (1) CM000324.1 100615163 .. 100615291 (129 bp)     Whole Genome Shotgun sequences (2) AADA01026879.1 4157 .. 4285 (129 bp)   AACZ02116734.1 3956 .. 4084 (129 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement