PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:24623 Links RH68501 Homo sapiens chromosome 12, locus WNK1 Macaca mulatta chromosome 11, locus WNK1 Pan troglodytes chromosome 12, locus WNK1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CACCCTGAGATGCTGATTC Reverse primer: CCCTCATGCAGATATGTAGTTG PCR product size: 166 (bp), Homo sapiens GenBank Accession: H57131    Homo sapiens Name: RH68501 Also known as: H57131 Polymorphism info:   Cross References Gene GeneID: 65125   Symbol: WNK1   Description: WNK lysine deficient protein kinase 1   Position: 12p13.3 Mapping Information RH68501 Sequence Map: Chr 12|Celera Map Viewer   Position: 2559038-2559203 (bp)   RH68501 Sequence Map: Chr 12|HuRef Map Viewer   Position: 803597-803762 (bp)   RH68501 Sequence Map: Chr 12 Map Viewer   Position: 823036-823201 (bp)   H57131 NCBI RH Map: Chr 12 Map Viewer   Position: 11 (cR)   Lod score: 1.08   H57131 GeneMap99-GB4 Map: Chr 12 Map Viewer   Position: 14.59 (cR3000)   Lod score: 0.00   Reference Interval: D12S91-D12S1608 Electronic PCR results Genomic (5 of 7)[Show All Hits] AC004765.2 113043 .. 113208 (166 bp)   CH003459.1 888655 .. 888820 (166 bp)   CH003507.1 860857 .. 861022 (166 bp)   CH471116.2 762620 .. 762785 (166 bp)   CM000263.1 2559038 .. 2559203 (166 bp)     ESTs (1) H57131.1 84 .. 249 (166 bp)     Whole Genome Shotgun sequences (4) AADD01120743.1 22100 .. 22265 (166 bp)   AADC01103279.1 123100 .. 123265 (166 bp)   AADB02014528.1 101951 .. 102116 (166 bp)   ABBA01048836.1 12373 .. 12538 (166 bp)        Macaca mulatta Name: RH68501 Polymorphism info:   Cross References Gene GeneID: 706493   Symbol: WNK1   Description: WNK lysine deficient protein kinase 1   Position:   Mapping Information RH68501 Sequence Map: Chr 11 Map Viewer   Position: 835131-835292 (bp)    Pan troglodytes Name: RH68501 Polymorphism info:   Cross References Gene GeneID: 451739   Symbol: WNK1   Description: WNK lysine deficient protein kinase 1   Position:   Mapping Information RH68501 Sequence Map: Chr 12 Map Viewer   Position: 866118-866281 (bp) Electronic PCR results Genomic (1) CM000326.1 866118 .. 866281 (164 bp)     Whole Genome Shotgun sequences (2) AADA01063825.1 22544 .. 22707 (164 bp)   AACZ02131282.1 11892 .. 12055 (164 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement