|
Using tbl2asn to Prepare an HTG Submission |
Sequin | Entrez | BLAST | OMIM | Taxonomy | Structure |
|
This document assumes that you are already familiar with the Sequin program. If you are not, please visit the Sequin home page at http://www.ncbi.nlm.nih.gov/Sequin.
Basic information about the commandline program tbl2asn is described on the tbl2asn home page. tbl2asn is available by anonymous FTP from ftp://ftp.ncbi.nih.gov/toolbox/ncbi_tools/converters/by_program/tbl2asn/. Copy the right version for your platform, then uncompress the file, rename it to "tbl2asn", and set the permissions (as necessary for the platform)
Before you create your first HTG submission, you need to make a Sequin submission template that contains contact and citation information. You can then use this template for subsequent submissions. To create the template, follow the instructions on the tbl2asn page: click on the "Start New Submission" button on the first Welcome to Sequin form. All of the information from the subsequent Submitting Authors form will be used for the HTG record. Enter a manuscript title, if desired. Fill out the Contact, Authors, and Affiliation pages carefully. Instructions are provided in the Sequin help documentation. Return to the submission tab and choose File-> Export Submitter info, and save the file as template.sbt.
Single, unsegmented sequences should be in standard FASTA format. Segmented sequences for phase 0, 1, or 2 HTGS should be in a modified FASTA format such as this: >P74A8 [chromosome=2] [clone=ABC12345] gatcagcccaaagcattgattaggggaacttacctgtagagggctgcagcaatggggaac acctggctgggtcacagagtggtcaatgcactccatgacttttgggtcaggacacagaaa gaaagagcggggaaccggggggccctacagtgatgaattatactaactgattttagaatg >segment2 ttaaacaaacattgcatttccagaataaaccccatttagtaacgcatagtgtgcttgtat ctcagcctcccaaagtgctgggattatagacatgagccagcgcacctggctttgttagcc >segment3 ttttcaaataactttttgaactttgttaattttttaattgcacgttttctccttcattta ctaattccattcaaaagtagcatcaatgagaataaattacttaggaatacatttaattaa aaagtgctagacttgtacactgaaaattacaaagtactctggagatatattc The first line has the Sequence Id (=SeqID or sequence name), P74A8, and source information. Each segment is separated by- >segmentxThis line must be unique among all the lines of FASTA-formatted sequence being processed (e.g., ">segment2", ">segment3", etc).
Because the information is useful to database users, please include the quality scores of unfinished (phase 0, 1 or 2) HTG records in the submission. If you are using .fsa files to include the sequences, then tbl2asn will include the associated CONSED/PHRAP quality scores in the output file if they are in a file named and formatted as described on the tbl2asn page. The instructions are: Put the scores in a .qvl file whose basename matches the fasta (.fsa) file's basename, and whose definition line has the same identifier (SeqID) as the corresponding .fsa file. Put this file in the same directory as the .fsa file. To account for gaps of unknown size (the default), include 100 zeroes between the contigs' scores.
Alternatively, you can import sequence and quality scores in the .ace file format, which is an output of Phrap. This format is not described here.
The source information must be included in the FASTA file definition line and/or the tbl2asn commandline. All of the source information, including the HTG phase, can be included in the FASTA file definition line. Alternatively, common information such as the organism name can be included in the commandline, and only unique information included in the FASTA file definition line, if desired. If the same qualifiers are present both places, the information in the FASTA definition line will be used. The source qualifiers are described on the tbl2asn page. The HTG phase is included as:
Keywords, such as HTGS_DRAFT, are included as:
A basic commandline for a new phase 2 submission is:
A commandline for an update must include the accession number:
In both cases the chromosome and clone names would be included in the definition line of the .fsa file. Type "tbl2asn -" to see the program's command line arguments. Note that several command line arguments were changed in version 10.0 of tbl2asn, to make it more flexible and expandable. Below, we list some arguments along with additional comments. tbl2asn 10.1 arguments: -i Filename for .fsa FASTA input [File In] -t Filename for Seq-submit template [File In] -p Path to Files [String] Optional
-x Suffix [String] Optional
-o Filename for ASN.1 output [File Out] Optional
-C Genome Center tag [String]
-j Source Qualifiers [String] Optional
-n Organism name [String] Optional
-Y Filename for the comment: [File In] Optional
-y Comment [String] Optional
-V Verification (combine any of the following letters) Optional
-a Specifies the File type.
-A Accession [String] Optional
When you are finished with the submission, deposit it on your FTP account under the "SEQSUBMIT" directory. Our software will look for it there every day, validate the center and sequence name ids, check whether the record is an update, and write a report that you can pick up the next day. Further information about how HTG records are processed is available from http://www.ncbi.nlm.nih.gov/HTGS/processing.html. Revised: February 13, 2008. Questions or Comments?
|