PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:3268 Links SGC30101 Homo sapiens chromosome 19, locus TNPO2 Macaca mulatta chromosome 19, locus LOC717710 Pan troglodytes chromosome 19, locus TNPO2 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AACTCAAACAACTCAATCAGTTTCC Reverse primer: CTTCACGTTGTTCTTGAGGATG PCR product size: 125 (bp), Homo sapiens GenBank Accession: G21864 T23666    Homo sapiens Name: SGC30101 Also known as: EST53188 WI-30101 Polymorphism info:   Cross References Gene GeneID: 30000   Symbol: TNPO2   Description: transportin 2   Position: 19p13.13 UniGene Hs.705399 Transportin 2 (importin 3, karyopherin beta 2b) Mapping Information SGC30101 Sequence Map: Chr 19|HuRef Map Viewer   Position: 12403179-12403385 (bp)   SGC30101 Sequence Map: Chr 19 Map Viewer   Position: 12690943-12691149 (bp)   SGC30101 Sequence Map: Chr 19|Celera Map Viewer   Position: 12719654-12719860 (bp)   SGC30101 NCBI RH Map: Chr 19 Map Viewer   Position: 87.9 (cR)   Lod score: 1.48   SGC30101 Whitehead-RH Map: Chr 19 Map Viewer   Position: 64.6 (cR3000)   Lod score: P2.98   SGC30101 GeneMap99-GB4 Map: Chr 19 Map Viewer   Position: 73.59 (cR3000)   Lod score: 0.80   Reference Interval: D19S221-D19S226 Electronic PCR results RefSeq mRNA (1) NM_013433.3 245 .. 369 (125 bp)     mRNA (5) AF007748.1 392 .. 516 (125 bp)   AF019039.1 225 .. 349 (125 bp)   AK056183.1 798 .. 922 (125 bp)   BC072420.1 245 .. 369 (125 bp)   AB210011.1 839 .. 963 (125 bp)     Genomic (5 of 9)[Show All Hits] G21864.1 15 .. 139 (125 bp)   AC018761.6 63848 .. 64054 (207 bp)   AY402708.1 101 .. 225 (125 bp)   CH003466.1 12879649 .. 12879855 (207 bp)   CH003514.1 14693894 .. 14694100 (207 bp)     ESTs (5 of 103)[Show All Hits] T23666.1 15 .. 139 (125 bp)   AI217523.1 317 .. 441 (125 bp)   AI222226.1 202 .. 326 (125 bp)   AU119841.1 176 .. 300 (125 bp)   BF346238.1 162 .. 286 (125 bp)     Whole Genome Shotgun sequences (4) AADD01163256.1 8430 .. 8636 (207 bp)   AADC01137574.1 21049 .. 21255 (207 bp)   AADB02020054.1 498667 .. 498873 (207 bp)   ABBA01029778.1 5992 .. 6198 (207 bp)        Macaca mulatta Name: SGC30101 Polymorphism info:   Cross References Gene GeneID: 717710   Symbol: LOC717710   Description: similar to transportin 2 (importin 3, karyopherin beta 2b)   Position:   Mapping Information SGC30101 Sequence Map: Chr 19 Map Viewer   Position: 12379706-12379913 (bp)    Pan troglodytes Name: SGC30101 Polymorphism info:   Cross References Gene GeneID: 455748   Symbol: TNPO2   Description: transportin 2   Position:   Mapping Information SGC30101 Sequence Map: Chr 19 Map Viewer   Position: 13084532-13084738 (bp) Electronic PCR results RefSeq mRNA (1) XM_512411.2 620 .. 744 (125 bp)     Genomic (2) AY402709.1 2 .. 126 (125 bp)   CM000333.1 13084532 .. 13084738 (207 bp)     Whole Genome Shotgun sequences (2) AADA01027134.1 565 .. 771 (207 bp)   AACZ02182587.1 605 .. 811 (207 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement