PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:62115 Links SHGC-61087 Homo sapiens chromosome 16, locus ZNF23 Macaca mulatta chromosome 20, locus LOC710814 Pan troglodytes chromosome 16, locus ZNF23 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TAGAGTATCTTTAGTACGGGTTT Reverse primer: GACTTGTATGGAGAAATTTAAGT PCR product size: 119 (bp), Homo sapiens    Homo sapiens Name: SHGC-61087 Also known as: A004N10 Polymorphism info:   Cross References Gene GeneID: 7571   Symbol: ZNF23   Description: zinc finger protein 23 (KOX 16)   Position: 16q22 UniGene Hs.656643 Zinc finger protein 23 (KOX 16)   Hs.703017 Transcribed locus, moderately similar to XP_226455.3 PREDICTED: similar to Z... Mapping Information SHGC-61087 Sequence Map: Chr 16|Celera Map Viewer   Position: 55797446-55797564 (bp)   SHGC-61087 Sequence Map: Chr 16|HuRef Map Viewer   Position: 57249637-57249755 (bp)   SHGC-61087 Sequence Map: Chr 16 Map Viewer   Position: 70039092-70039210 (bp)   A004N10 NCBI RH Map: Chr 16 Map Viewer   Position: 562.1 (cR)   Lod score: 1.05   A004N10 GeneMap99-GB4 Map: Chr 16 Map Viewer   Position: 430.73 (cR3000)   Lod score: 0.01   Reference Interval: D16S3139-D16S512 Electronic PCR results RefSeq mRNA (1) NM_145911.1 3033 .. 3151 (119 bp)     mRNA (5 of 8)[Show All Hits] AL080123.1 2072 .. 2190 (119 bp)   AF226996.1 1536 .. 1654 (119 bp)   BC007256.1 3033 .. 3151 (119 bp)   AF507946.1 3033 .. 3151 (119 bp)   AL833815.1 2812 .. 2930 (119 bp)     Genomic (5 of 8)[Show All Hits] G30264.1 95 .. 213 (119 bp)   AC010547.9 53615 .. 53733 (119 bp)   CH003463.1 52403005 .. 52403123 (119 bp)   CH003511.1 57672913 .. 57673031 (119 bp)   CH471166.2 289584 .. 289702 (119 bp)     ESTs (5 of 34)[Show All Hits] R41983.1 96 .. 215 (120 bp)   R49071.1 95 .. 213 (119 bp)   R46011.1 97 .. 215 (119 bp)   R44520.1 95 .. 213 (119 bp)   H21904.1 78 .. 196 (119 bp)     Whole Genome Shotgun sequences (4) AADD01149846.1 9729 .. 9847 (119 bp)   AADC01126863.1 55763 .. 55881 (119 bp)   AADB02017630.1 177447 .. 177565 (119 bp)   ABBA01016777.1 62931 .. 63049 (119 bp)        Macaca mulatta Name: SHGC-61087 Polymorphism info:   Cross References Gene GeneID: 710814   Symbol: LOC710814   Description: similar to zinc finger protein 23   Position:   Mapping Information SHGC-61087 Sequence Map: Chr 20 Map Viewer   Position: 71212006-71212124 (bp)    Pan troglodytes Name: SHGC-61087 Polymorphism info:   Cross References Gene GeneID: 468017   Symbol: ZNF23   Description: zinc finger protein 23 (KOX 16)   Position:   Mapping Information SHGC-61087 Sequence Map: Chr 16 Map Viewer   Position: 71303217-71303335 (bp) Electronic PCR results RefSeq mRNA (1) XM_523409.2 2367 .. 2485 (119 bp)     Genomic (1) CM000330.1 71303217 .. 71303335 (119 bp)     Whole Genome Shotgun sequences (2) AADA01034829.1 6129 .. 6247 (119 bp)   AACZ02164099.1 6131 .. 6249 (119 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement