refSNP ID: rs1053246 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 86/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/G Ancestral Allele: G Clinical Association: unknown HGVS Names NM_032548.2:c.*362C>T NM_172027.1:c.*362C>T NM_172028.1:c.*362C>T NT_005612.15:g.33894826C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss1530282 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs1053246 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss1530282 LEE|530692 fwd/T A/G aatggccctgtgcatgggaacaccagctta agaagcaattcagggctaggcaagggccag 09/13/00 10/10/03 86 cDNA unknown ss4419735 LEE|e530692 fwd/T A/G aatggccctgtgcatgggaacaccagctta agaagcaattcagggctaggcaagggccag 04/26/02 10/10/03 106 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs1053246|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/G'|mol=cDNA|build=106 CACTCCCCCA GCCCTTCCTG AATGGCCCTG TGCATGGGAA CACCAGCTTA R AGAAGCAATT CAGGGCTAGG CAAGGGCCAG AGGACTGGAT TTGGGACTGG   GeneView GeneView via analysis of contig annotation: ABTB1 ankyrin repeat and BTB (POZ) domain containing 1 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_005612->NM_032548 function reference NT_005612->NM_172027 function reference NT_005612->NM_172028 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_005612->NM_032548-> 33894826 forward 1898 3' UTR reference NT_005612->NM_172027-> 33894826 forward 1887 3' UTR reference NT_005612->NM_172028-> 33894826 forward 1852 3' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs1053246 maps exactly once on NCBI human chromosome 3 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 3 NW_001838883.1 527976 124780450 minus C alt_assembly_8 HuRef HuRef view 50 3 NW_921807.1 34012213 125826543 minus C alt_assembly_1 Celera Celera view 50 3 NT_005612.15 33894826 128882370 minus C ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank AW003451 Hs.107812 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank mRNA: NM_032548.2 NM_172027.1 NM_172028.1 AB053324.1 AB053325.1 AB053326.1 AF447886.1 AK130594.1 BC011858.2 UniGene Cluster ID 107812   Population Diversity Sample Ascertainment Genotypes Alleles ss# Population Individual Group Chrom. Sample Cnt. Source HWP A G ss1530282 CEPH 184 AF 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0 0 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .