PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:78300 Links RH36181 Homo sapiens chromosome 5 Pan troglodytes chromosome 5 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTCCATGATGTGCTCAGACC Reverse primer: CTTTCCACTTAGCCAAGACACC PCR product size: 105 (bp), Homo sapiens    Homo sapiens Name: RH36181 Also known as: stSG12722 Polymorphism info:   Cross References Mapping Information RH36181 Sequence Map: Chr 5|HuRef Map Viewer   Position: 12415165-12415269 (bp)   RH36181 Sequence Map: Chr 5|Celera Map Viewer   Position: 12468469-12468573 (bp)   RH36181 Sequence Map: Chr 5 Map Viewer   Position: 12486850-12486954 (bp)   stSG12722 NCBI RH Map: Chr 5 Map Viewer   Position: 53.1 (cR)   Lod score: 1.26   stSG12722 GeneMap99-GB4 Map: Chr 5 Map Viewer   Position: 39.72 (cR3000)   Lod score: 3.00   Reference Interval: D5S630-D5S478 Electronic PCR results Genomic (5 of 8)[Show All Hits] AC004768.1 118931 .. 119035 (105 bp)   AC108121.2 48834 .. 48938 (105 bp)   CH003452.1 12561223 .. 12561327 (105 bp)   CH003500.1 13166280 .. 13166384 (105 bp)   CH471102.2 11570901 .. 11571005 (105 bp)     ESTs (1) H47336.1 67 .. 171 (105 bp)     Whole Genome Shotgun sequences (4) AADD01055800.1 410 .. 514 (105 bp)   AADC01048882.1 149692 .. 149796 (105 bp)   AADB02008345.1 152848 .. 152952 (105 bp)   ABBA01020617.1 358083 .. 358187 (105 bp)        Pan troglodytes Name: RH36181 Polymorphism info:   Mapping Information RH36181 Sequence Map: Chr 5 Map Viewer   Position: 12653928-12654032 (bp) Electronic PCR results Genomic (1) CM000319.1 12653928 .. 12654032 (105 bp)     Whole Genome Shotgun sequences (2) AADA01021294.1 673 .. 777 (105 bp)   AACZ02058225.1 39962 .. 40066 (105 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement