refSNP ID: rs3786063 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 107/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: C Clinical Association: unknown HGVS Names NM_018146.2:c.728-1358C>T NT_010718.15:g.296790C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss4972422 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3786063 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss4972422 YUSUKE|IMS-JST142703 fwd/B C/T tgcgggggagggtgggaggccatgcagtca tgcgaggccccaccctcggccactctccca 08/12/02 10/10/03 107 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3786063|allelePos=61|totalLen=121|taxid=9606|snpclass=1|alleles='C/T'|mol=Genomic|build=107 CGTCAGGAGA AGACTTGCGC TAACAAGCTG TGCGGGGGAG GGTGGGAGGC CATGCAGTCA Y TGCGAGGCCC CACCCTCGGC CACTCTCCCA GCCCGCCCGT GGTGAGGAGC CGCCCCTGGG   GeneView GeneView via analysis of contig annotation: RNMTL1 RNA methyltransferase like 1 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_010718->NM_018146 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_010718->NM_018146->NP_060616 296790 forward intron GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3786063 maps exactly once on NCBI human chromosome 17 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 17 NW_001838403.1 295182 604012 plus C alt_assembly_8 HuRef HuRef view 60 17 NT_010718.15 296790 640166 plus C ref_assembly reference reference view 60 17 NW_926584.1 623052 705556 plus C alt_assembly_1 Celera Celera view 60   NCBI Resource Links Submitter-Referenced GenBank NT_010830.1 dbSNP Blast Analysis   Population Diversity Sample Ascertainment Genotype Detail Alleles ss# Population Individual Group Chrom. Sample Cnt. Source C/C C/T HWP C T ss4972422 JBIC-allele 1496 AF 0.912 0.088 HapMap-CEU European 120 IG 0.983 0.017 1.000 0.992 0.008 HapMap-HCB Asian 90 IG 0.933 0.067 1.000 0.967 0.033 HapMap-JPT Asian 88 IG 0.886 0.114 0.752 0.943 0.057 HapMap-YRI Sub-Saharan African 118 IG 1.000 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0.042+/-0.139 270 210 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .