refSNP ID: rs3209867 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 105/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/C Ancestral Allele: C Clinical Association: unknown HGVS Names NM_004383.1:c.*560C>A NT_010194.16:g.45885732C>A Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss4440477 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3209867 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss4440477 LEE|e1841953 fwd/T A/C ccatgttgcactgtttgcatgcgcccgagg agacgtctgtcaggggcttggatttcgtgt 04/26/02 10/10/03 105 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3209867|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/C'|mol=cDNA|build=105 CGCCCCGTGT TTGCGCTTGA CCATGTTGCA CTGTTTGCAT GCGCCCGAGG M AGACGTCTGT CAGGGGCTTG GATTTCGTGT GCCGCTGCCA CCCGCCCACC   GeneView GeneView via analysis of contig annotation: CSK c-src tyrosine kinase View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_010194->NM_004383 function HuRef NW_001838219->NM_004383 function Celera NW_925907->NM_004383 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_010194->NM_004383-> 45885732 forward 2325 3' UTR HuRef NW_001838219->NM_004383-> 701510 forward 2325 3' UTR Celera NW_925907->NM_004383-> 702004 forward 2325 3' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3209867 maps exactly once on NCBI human chromosome 15 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 15 NW_001838219.1 701510 51892619 plus C alt_assembly_8 HuRef HuRef view 50 15 NW_925907.1 702004 52045443 plus C alt_assembly_1 Celera Celera view 50 15 NT_010194.16 45885732 72882467 plus C ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank AI345213 Hs.77793 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank mRNA: NM_004383.1 BC104847.1 BC104875.1 X59932.1 X60114.1   Population Diversity Sample Ascertainment Genotypes Alleles ss# Population Individual Group Chrom. Sample Cnt. Source HWP A C ss4440477 CEPH 184 AF 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0 0 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .