refSNP ID: rs2275677 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 100/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/G Ancestral Allele: A Clinical Association: unknown HGVS Names NM_015155.1:c.647-196T>C NT_077567.3:g.822642A>G Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss3211850 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs2275677 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss3211850 YUSUKE|IMS-JST071934 fwd/T A/G acatttaaaatcctgcaggagccataatgt tgtaacactatgaaacaaaggttctaaaca 09/05/01 10/10/03 100 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs2275677|allelePos=61|totalLen=121|taxid=9606|snpclass=1|alleles='A/G'|mol=Genomic|build=100 CGTTAGATTT TTCAAAGCTC AGGAATATGG ACATTTAAAA TCCTGCAGGA GCCATAATGT R TGTAACACTA TGAAACAAAG GTTCTAAACA GCTCAAGCAC TAAGAGCAGA TGAAAATACA   GeneView GeneView via analysis of contig annotation: LARP5 La ribonucleoprotein domain family, member 5 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_077567->NM_015155 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_077567->NM_015155->NP_055970 822642 reverse intron GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs2275677 maps exactly once on NCBI human chromosome 10 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 10 NW_001837930.2 4521611 821988 minus T alt_assembly_8 HuRef HuRef view 60 10 NW_924584.1 832965 832965 plus A alt_assembly_1 Celera Celera view 60 10 NT_077567.3 822642 872642 plus A ref_assembly reference reference view 60   NCBI Resource Links Submitter-Referenced GenBank AL359878.3 dbSNP Blast Analysis GenBank HTGS Finished: AL359878.13   Population Diversity Sample Ascertainment Genotype Detail Alleles ss# Population Individual Group Chrom. Sample Cnt. Source A/A A/G HWP A G ss3211850 JBIC-allele 1494 AF 0.918 0.082 HapMap-CEU European 120 IG 0.967 0.033 1.000 0.983 0.017 HapMap-HCB Asian 90 IG 0.844 0.156 0.584 0.922 0.078 HapMap-JPT Asian 88 IG 0.818 0.182 0.527 0.909 0.091 HapMap-YRI Sub-Saharan African 120 IG 1.000 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0.078+/-0.181 270 210 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .