PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:67160 Links RH25293 Homo sapiens chromosome 5, locus GNPDA1 Pan troglodytes chromosome 5, locus GNPDA1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TCCTTACACGCACTGATTTTC Reverse primer: CTGTGAAAGTGGAAGAAGGAA PCR product size: 228 (bp), Homo sapiens    Homo sapiens Name: RH25293 Also known as: GDB:679150 KIAA0060 Polymorphism info:   Cross References Gene GeneID: 10007   Symbol: GNPDA1   Description: glucosamine-6-phosphate deaminase 1   Position: 5q21 UniGene Hs.633853 Glucosamine-6-phosphate deaminase 1 Mapping Information RH25293 Sequence Map: Chr 5|HuRef Map Viewer   Position: 136527548-136527775 (bp)   RH25293 Sequence Map: Chr 5|Celera Map Viewer   Position: 137461809-137462036 (bp)   RH25293 Sequence Map: Chr 5 Map Viewer   Position: 141361213-141361451 (bp)   KIAA0060 NCBI RH Map: Chr 5 Map Viewer   Position: 891.6 (cR)   Lod score: 1.68   KIAA0060 GeneMap99-GB4 Map: Chr 5 Map Viewer   Position: 528.28 (cR3000)   Lod score: 0.07   Reference Interval: D5S500-D5S436 Electronic PCR results RefSeq mRNA (1) NM_005471.3 1236 .. 1463 (228 bp)     mRNA (5 of 6)[Show All Hits] D31766.1 1598 .. 1825 (228 bp)   AF029914.1 1210 .. 1437 (228 bp)   AJ002231.1 1956 .. 2183 (228 bp)   AF037332.1 817 .. 1044 (228 bp)   AK022779.1 1134 .. 1361 (228 bp)     Genomic (5 of 9)[Show All Hits] G06541.1 327 .. 554 (228 bp)   AC005740.1 67097 .. 67335 (239 bp)   CH003452.1 138707988 .. 138708215 (228 bp)   CH003500.1 143221178 .. 143221405 (228 bp)   CH471062.2 15089825 .. 15090052 (228 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC010264.5 110516 .. 110743 (228 bp)     ESTs (5 of 30)[Show All Hits] BE548196.1 92 .. 317 (226 bp)   BF038432.1 387 .. 614 (228 bp)   AU123747.1 67 .. 294 (228 bp)   BF339511.1 156 .. 378 (223 bp)   BF341669.1 65 .. 293 (229 bp)     Whole Genome Shotgun sequences (4) AADD01064012.1 1705 .. 1932 (228 bp)   AADC01055423.1 73390 .. 73617 (228 bp)   AADB02009562.1 73431 .. 73658 (228 bp)   ABBA01026392.1 45035 .. 45262 (228 bp)        Pan troglodytes Name: RH25293 Polymorphism info:   Cross References Gene GeneID: 738888   Symbol: GNPDA1   Description: glucosamine-6-phosphate deaminase 1   Position:   Mapping Information RH25293 Sequence Map: Chr 5 Map Viewer   Position: 143804771-143805009 (bp) Electronic PCR results RefSeq mRNA (1) XM_001139968.1 1413 .. 1651 (239 bp)     Genomic (1) CM000319.1 143804771 .. 143805009 (239 bp)     Whole Genome Shotgun sequences (2) AADA01078227.1 2449 .. 2687 (239 bp)   AACZ02064753.1 80174 .. 80412 (239 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement