PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:26870 Links D6S294 Homo sapiens chromosome 6, locus HCRTR2 Pan troglodytes chromosome 6, locus HCRTR2 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CAGGTTTGTCCAAGATTTCA Reverse primer: CTAAAGTCTCCATCTTCGATTG PCR product size: 249 (bp), Homo sapiens GenBank Accession: Z16922    Homo sapiens Name: D6S294 Also known as: AFM205yc7 SHGC-915 Polymorphism info:   Cross References Gene GeneID: 3062   Symbol: HCRTR2   Description: hypocretin (orexin) receptor 2   Position: 6p12 Mapping Information D6S294 Sequence Map: Chr 6|HuRef Map Viewer   Position: 54978932-54979178 (bp)   D6S294 Sequence Map: Chr 6 Map Viewer   Position: 55252094-55252342 (bp)   D6S294 Sequence Map: Chr 6|Celera Map Viewer   Position: 56805682-56805930 (bp)   SHGC-915 NCBI RH Map: Chr 6 Map Viewer   Position: 725.7 (cR)   Lod score: 3.79   SHGC-915 TNG Map: Chr 6 Map Viewer   Position: 27539 (cR50000)   Lod score: 14.6   Reference Interval: 68   SHGC-915 Stanford-G3 Map: Chr 6 Map Viewer   Position: 2902 (cR10000)   Lod score: F   Reference Interval: 51   AFM205yc7 GeneMap99-G3 Map: Chr 6 Map Viewer   Position: 3034 (cR10000)   Lod score: F   Reference Interval: D6S294-D6S430 Electronic PCR results Genomic (5 of 9)[Show All Hits] Z16922.1 66 .. 314 (249 bp)   AL449104.5 91334 .. 91582 (249 bp)   AY062031.1 126013 .. 126271 (259 bp)   CH003453.1 55636193 .. 55636439 (247 bp)   CH003501.1 57507857 .. 57508103 (247 bp)     Whole Genome Shotgun sequences (4) AADD01070074.1 38467 .. 38713 (247 bp)   AADC01060080.1 33799 .. 34045 (247 bp)   AADB02010034.1 2693561 .. 2693809 (249 bp)   ABBA01050507.1 260160 .. 260406 (247 bp)        Pan troglodytes Name: D6S294 Polymorphism info:   Cross References Gene GeneID: 462786   Symbol: HCRTR2   Description: hypocretin (orexin) receptor 2   Position:   Mapping Information D6S294 Sequence Map: Chr 6 Map Viewer   Position: 56530328-56530622 (bp) Electronic PCR results Genomic (1) CM000320.1 56530328 .. 56530622 (295 bp)     Whole Genome Shotgun sequences (2) AADA01072402.1 8524 .. 8818 (295 bp)   AACZ02072086.1 12118 .. 12412 (295 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement