refSNP ID: rs2276325 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 100/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: C Clinical Association: unknown HGVS Names NM_015315.3:c.663C>T NM_033551.2:c.894C>T NP_056130.2:p.P221P NP_291029.2:p.P298P NT_029289.10:g.15336320C>T Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss3212792 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs2276325 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss3212792 YUSUKE|IMS-JST072876 fwd/B C/T catagggtctgagtctgccacctacgtgcc gtggccccccccaccccagcctggcaacca 09/05/01 10/10/03 100 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs2276325|allelePos=61|totalLen=121|taxid=9606|snpclass=1|alleles='C/T'|mol=Genomic|build=100 CCCTCAGGCC TGACCTGGTA CCCCTCTCCC CATAGGGTCT GAGTCTGCCA CCTACGTGCC Y GTGGCCCCCC CCACCCCAGC CTGGCAACCA GAGATCAAAC CGGAGCCTGC CTGGCACGAC   GeneView GeneView via analysis of contig annotation: LARP1 La ribonucleoprotein domain family, member 1 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_029289->NM_015315 function reference NT_029289->NM_033551 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_029289->NM_015315->NP_056130 15336321 forward 687 synonymous T Pro [P] 3 221 contig reference C Pro [P] 3 221 reference NT_029289->NM_033551->NP_291029 15336321 forward 1323 synonymous T Pro [P] 3 298 contig reference C Pro [P] 3 298 GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs2276325 maps exactly once on NCBI human chromosome 5 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 5 NW_001838953.2 966540 149315705 minus G alt_assembly_8 HuRef HuRef view 60 5 NW_922784.1 27878888 150250872 plus C alt_assembly_1 Celera Celera view 60 5 NT_029289.10 15336321 154153578 plus C ref_assembly reference reference view 60   NCBI Resource Links Submitter-Referenced GenBank AP002016.2 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank HTGS Draft: NM_015315.3 NM_033551.2 AP002016.2   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .