PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:33605 Links RH44677 Homo sapiens chromosome 14, locus SLC25A21 Pan troglodytes chromosome 14, locus SLC25A21 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CCTGGGGAGGAAAAAAATTC Reverse primer: CCCATGATCATTCACTGCAC PCR product size: 124 (bp), Homo sapiens    Homo sapiens Name: RH44677 Also known as: stSG9143 Polymorphism info:   Cross References Gene GeneID: 89874   Symbol: SLC25A21   Description: solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21   Position: 14q11.2 Mapping Information RH44677 Sequence Map: Chr 14|Celera Map Viewer   Position: 17246048-17246171 (bp)   RH44677 Sequence Map: Chr 14|HuRef Map Viewer   Position: 17496863-17496986 (bp)   RH44677 Sequence Map: Chr 14 Map Viewer   Position: 36452193-36452316 (bp)   stSG9143 NCBI RH Map: Chr 14 Map Viewer   Position: 241.3 (cR)   Lod score: 2.07   stSG9143 GeneMap99-GB4 Map: Chr 14 Map Viewer   Position: 76.17 (cR3000)   Lod score: 1.14   Reference Interval: D14S70-D14S281 Electronic PCR results Genomic (5 of 10)[Show All Hits] AC068812.13 63450 .. 63573 (124 bp)   AL121775.3 169847 .. 169970 (124 bp)   AL162464.5 15539 .. 15662 (124 bp)   AL954800.2 17302481 .. 17302604 (124 bp)   CH003461.1 17163959 .. 17164082 (124 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC010813.3 144829 .. 144952 (124 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC024285.1 28454 .. 28577 (124 bp)     ESTs (3) T67533.1 122 .. 245 (124 bp)   R02083.1 135 .. 261 (127 bp)   BX103887.1 618 .. 741 (124 bp)     Whole Genome Shotgun sequences (5) AADD01137007.1 71493 .. 71616 (124 bp)   AADC01116560.1 14592 .. 14715 (124 bp)   AADB02134081.1 17 .. 142 (126 bp)   AADB02016068.1 388936 .. 389059 (124 bp)   ABBA01061528.1 265334 .. 265457 (124 bp)        Pan troglodytes Name: RH44677 Polymorphism info:   Cross References Gene GeneID: 467433   Symbol: SLC25A21   Description: solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21   Position:   Mapping Information RH44677 Sequence Map: Chr 14 Map Viewer   Position: 36036332-36036455 (bp) Electronic PCR results Genomic (1) CM000328.1 36036332 .. 36036455 (124 bp)     Whole Genome Shotgun sequences (2) AADA01053405.1 10113 .. 10236 (124 bp)   AACZ02147883.1 18397 .. 18520 (124 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement