PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:21588 Links RH48807 Homo sapiens chromosome 19, locus CBLC Pan troglodytes locus LOC456117 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: ATTTCTGGGCTTCCTGGG Reverse primer: GCTGAGGACTCAGGGAACAG PCR product size: 120 (bp), Homo sapiens    Homo sapiens Name: RH48807 Also known as: stSG31317 Polymorphism info:   Cross References Gene GeneID: 23624   Symbol: CBLC   Description: Cas-Br-M (murine) ecotropic retroviral transforming sequence c   Position: 19q13.2 UniGene Hs.466907 Cas-Br-M (murine) ecotropic retroviral transforming sequence c Mapping Information View all results using the Map Viewer   stSG31317 NCBI RH Map: Chr 19 Map Viewer   Position: 484.8 (cR)   Lod score: 1.74   stSG31317 GeneMap99-GB4 Map: Chr 19 Map Viewer   Position: 250.82 (cR3000)   Lod score: 1.03   Reference Interval: D19S425-D19S418 Electronic PCR results RefSeq mRNA (1) NM_012116.2 1269 .. 1388 (120 bp)     mRNA (4) AF117646.1 1291 .. 1410 (120 bp)   AF117647.1 1153 .. 1272 (120 bp)   AB028645.1 1269 .. 1388 (120 bp)   BC028915.1 1249 .. 1368 (120 bp)     Genomic (5 of 8)[Show All Hits] AC092066.4 130232 .. 130934 (703 bp)   CH003466.1 42615485 .. 42616187 (703 bp)   CH003514.1 46115485 .. 46116187 (703 bp)   DQ046987.1 1228 .. 1347 (120 bp)   CH471126.1 7507017 .. 7507719 (703 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC021988.4 118437 .. 119140 (704 bp)   AC083983.2 67317 .. 68019 (703 bp)     ESTs (5 of 7)[Show All Hits] AA113289.1 168 .. 287 (120 bp)   AI368245.1 171 .. 290 (120 bp)   AI660567.1 180 .. 299 (120 bp)   AI690580.1 177 .. 296 (120 bp)   BE464528.1 366 .. 485 (120 bp)     Whole Genome Shotgun sequences (4) AADD01165809.1 7259 .. 7961 (703 bp)   AADC01139761.1 12698 .. 13400 (703 bp)   AADB02020178.1 124328 .. 125030 (703 bp)   ABBA01040884.1 26477 .. 27179 (703 bp)        Pan troglodytes   Polymorphism info:   Cross References Gene GeneID: 456117   Symbol: LOC456117   Description: similar to Cas-Br-M (murine) ecotropic retroviral transforming sequence c   Position:   Electronic PCR results RefSeq mRNA (1) XR_023834.1 910 .. 1029 (120 bp)     Genomic (1) CM000333.1 50386770 .. 50387547 (778 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC120211.2 57950 .. 58689 (740 bp)     Whole Genome Shotgun sequences (2) AADA01211371.1 1968 .. 2745 (778 bp)   AACZ02185836.1 1963 .. 2740 (778 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement