PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:49453 Links RH41775 Homo sapiens chromosome 14, locus RABGGTA Pan troglodytes chromosome 14, locus RABGGTA Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GCGGTGGGCATCTTGGAGCAACT Reverse primer: TGAGAGGGCCTCTCCATTCTTTA PCR product size: 131 (bp), Homo sapiens    Homo sapiens Name: RH41775 Also known as: STS-F15673 sts-F15673 Polymorphism info:   Cross References Gene GeneID: 5875   Symbol: RABGGTA   Description: Rab geranylgeranyltransferase, alpha subunit   Position: 14q11.2 UniGene Hs.377992 Rab geranylgeranyltransferase, alpha subunit Mapping Information RH41775 Sequence Map: Chr 14 Map Viewer   Position: 23804593-23804723 (bp)   RH41775 Sequence Map: Chr 14|Celera Map Viewer   Position: 4599369-4599499 (bp)   RH41775 Sequence Map: Chr 14|HuRef Map Viewer   Position: 4849910-4850040 (bp)   sts-F15673 NCBI RH Map: Chr 14 Map Viewer   Position: 31 (cR)   Lod score: 1.82   sts-F15673 GeneMap99-GB4 Map: Chr 14 Map Viewer   Position: 20.64 (cR3000)   Lod score: 0.00   Reference Interval: D14S283-D14S275 Electronic PCR results RefSeq mRNA (2) NM_182836.1 1807 .. 1937 (131 bp)   NM_004581.3 2064 .. 2194 (131 bp)     mRNA (4) Y08200.1 1916 .. 2046 (131 bp)   BC003093.1 1775 .. 1905 (131 bp)   AK291347.1 1721 .. 1851 (131 bp)   AK292613.1 1886 .. 2016 (131 bp)     Genomic (5 of 10)[Show All Hits] AF005631.1 114 .. 244 (131 bp)   AL096870.5 124278 .. 124408 (131 bp)   AL954800.2 4654881 .. 4655011 (131 bp)   CH003461.1 4537356 .. 4537486 (131 bp)   CH003509.1 4374037 .. 4374167 (131 bp)     ESTs (5 of 63)[Show All Hits] F01909.1 8 .. 138 (131 bp)   R49616.1 36 .. 166 (131 bp)   AA367710.1 5 .. 135 (131 bp)   AA527551.1 11 .. 140 (130 bp)   AA584230.1 47 .. 176 (130 bp)     Whole Genome Shotgun sequences (4) AADD01136130.1 15311 .. 15441 (131 bp)   AADC01116326.1 215492 .. 215622 (131 bp)   AADB02016061.1 2779596 .. 2779726 (131 bp)   ABBA01061340.1 15282 .. 15412 (131 bp)        Pan troglodytes Name: RH41775 Polymorphism info:   Cross References Gene GeneID: 452815   Symbol: RABGGTA   Description: Rab geranylgeranyltransferase, alpha subunit   Position:   Mapping Information RH41775 Sequence Map: Chr 14 Map Viewer   Position: 23171257-23171387 (bp) Electronic PCR results RefSeq mRNA (1) XM_509870.2 1819 .. 1949 (131 bp)     Genomic (1) CM000328.1 23171257 .. 23171387 (131 bp)     Whole Genome Shotgun sequences (2) AADA01232322.1 19858 .. 19988 (131 bp)   AACZ02147194.1 15915 .. 16045 (131 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement