PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:78900 Links SHGC-32613 Homo sapiens chromosome 3, locus PTPRG Pan troglodytes chromosome 3, locus PTPRG Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTCTCTCCCACTCTTTTCGTC Reverse primer: TAGATCATGCTGACTGCCCG PCR product size: 150 (bp), Homo sapiens GenBank Accession: G25790 G27613 H90744    Homo sapiens Name: SHGC-32613 Also known as: EST393155 SGC32613 Polymorphism info:   Cross References Gene GeneID: 5793   Symbol: PTPRG   Description: protein tyrosine phosphatase, receptor type, G   Position: 3p21-p14 Mapping Information SHGC-32613 Sequence Map: Chr 3 Map Viewer   Position: 61758463-61758612 (bp)   SHGC-32613 Sequence Map: Chr 3|Celera Map Viewer   Position: 61796303-61796452 (bp)   SHGC-32613 Sequence Map: Chr 3|HuRef Map Viewer   Position: 61882353-61882502 (bp)   SHGC-32613 NCBI RH Map: Chr 3 Map Viewer   Position: 596.4 (cR)   Lod score: 2.02   SHGC-32613 Stanford-G3 Map: Chr 3 Map Viewer   Position: 2851 (cR10000)   Lod score: F   Reference Interval: 50   SGC32613 Whitehead-RH Map: Chr 3 Map Viewer   Position: 229.7 (cR3000)   Lod score: P1.40   SHGC-32613 GeneMap99-G3 Map: Chr 3 Map Viewer   Position: 2749 (cR10000)   Lod score: F   Reference Interval: D3S1547-D3S1261   SGC32613 GeneMap99-GB4 Map: Chr 3 Map Viewer   Position: 198.02 (cR3000)   Lod score: 0.02   Reference Interval: D3S1547-D3S1261 Electronic PCR results mRNA (1) AK129954.1 107 .. 256 (150 bp)     Genomic (5 of 9)[Show All Hits] G25790.1 1 .. 150 (150 bp)   G27613.1 1 .. 150 (150 bp)   AC098482.2 18942 .. 19091 (150 bp)   CH003450.1 61975878 .. 61976027 (150 bp)   CH003498.1 66563303 .. 66563452 (150 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC068168.2 72158 .. 72307 (150 bp)   AC069295.6 26300 .. 26449 (150 bp)     ESTs (4) H90744.1 1 .. 150 (150 bp)   AA866149.1 5 .. 154 (150 bp)   BF431170.1 5 .. 154 (150 bp)   DB310397.1 5 .. 154 (150 bp)     Whole Genome Shotgun sequences (4) AADD01033452.1 406 .. 555 (150 bp)   AADC01029650.1 30513 .. 30662 (150 bp)   AADB02003848.1 397408 .. 397557 (150 bp)   ABBA01024337.1 37734 .. 37883 (150 bp)        Pan troglodytes Name: SHGC-32613 Polymorphism info:   Cross References Gene GeneID: 460484   Symbol: PTPRG   Description: protein tyrosine phosphatase, receptor type, G   Position:   Mapping Information SHGC-32613 Sequence Map: Chr 3 Map Viewer   Position: 63225198-63225347 (bp) Electronic PCR results Genomic (1) CM000317.1 63225198 .. 63225347 (150 bp)     Whole Genome Shotgun sequences (2) AADA01277399.1 2786 .. 2935 (150 bp)   AACZ02036934.1 3627 .. 3776 (150 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement