CDS GC%: 37.2% tRNA GC%: 56.7% rRNA GC%: 52.1%
IGS# | Up stream Locus | Up stream Product | Down Stream Locus | Down Stream Product | Gene Dir type | Start | End | IGS Len | GC% | IS NT | IS AA | NR | PT-Pair | Intra Spp. IGS | Inter Spp. IGS | Conserved Inter-spp IGS Start | Conserved Inter-spp IGS End | Blast Result | Conserved IGS Seq |
1 | TDE2786 | DNA polymerase III subunit alpha | TDE0001 | chromosomal replication initiator protein DnaA | <-<- | 1 | 2843201 | 604 | 29.8% | 0 | 0 | 0 | +: 2/0/0 | -: 2/2/3 | 1 | 0 | 0 | 0 | Result | |
2 | TDE0001 | chromosomal replication initiator protein DnaA | TDE0002 | DNA gyrase, B subunit | <--> | 1576 | 1683 | 108 | 25% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
3 | TDE0006 | Snf2 family protein | TDE0007 | hypothetical protein | <--> | 9785 | 10013 | 229 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
4 | TDE0007 | hypothetical protein | TDE0008 | copper-translocating P-type ATPase | ->-> | 10869 | 11030 | 162 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
5 | TDE0008 | copper-translocating P-type ATPase | TDE0009 | hypothetical protein | -><- | 13707 | 13813 | 107 | 34.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
6 | TDE0010 | MutT/nudix family protein | TDE0011 | alkyl hydroperoxide reductase/peroxiredoxin | ->-> | 15287 | 15547 | 261 | 26.1% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
7 | TDE0011 | alkyl hydroperoxide reductase/peroxiredoxin | TDE0012 | carbon starvation protein CstA, putative | ->-> | 16196 | 16307 | 112 | 29.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
8 | TDE0013 | methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase | TDE0014 | hypothetical protein | <--> | 18730 | 18929 | 200 | 24% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
9 | TDE0017 | hypothetical protein | TDE0018 | LysM domain protein | <-<- | 23027 | 23162 | 136 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
10 | TDE0019 | formate--tetrahydrofolate ligase | TDE0020 | glycyl-tRNA synthetase | <--> | 25420 | 25585 | 166 | 24.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
12 | TDE0029 | ABC transporter, ATP-binding protein, HlyB family | TDE0030 | prolipoprotein diacylglyceryl transferase, putative | <-<- | 37813 | 38017 | 205 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
13 | TDE0030 | prolipoprotein diacylglyceryl transferase, putative | TDE0031 | hypothetical protein | <-<- | 38798 | 38924 | 127 | 22.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
14 | TDE0031 | hypothetical protein | TDE0032 | histidine kinase-related ATPase, putative | <-<- | 39186 | 39320 | 135 | 20.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
15 | TDE0034 | hypothetical protein | TDE0035 | acetyltransferase, GNAT family | <-<- | 41541 | 41669 | 129 | 39.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
16 | TDE0035 | acetyltransferase, GNAT family | TDE0036 | hypothetical protein | <-<- | 42111 | 42224 | 114 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
17 | TDE0037 | transcriptional regulator, AbrB family | TDE0038 | 3-oxoacyl-(acyl-carrier-protein) synthase II | <-<- | 42890 | 43125 | 236 | 25.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
20 | TDE0040 | AMP-binding protein | TDE0041 | birA bifunctional protein | <--> | 47519 | 47636 | 118 | 27.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
21 | TDE0041 | birA bifunctional protein | TDE0042 | phosphate acetyltransferase | ->-> | 48696 | 48815 | 120 | 24.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
22 | TDE0044 | ABC transporter, ATP-binding protein | TDE0045 | ABC transporter, ATP-binding protein | <-<- | 53223 | 53358 | 136 | 20.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
23 | TDE0048 | hypothetical protein | TDE0049 | hypothetical protein | <-<- | 57913 | 58288 | 376 | 44.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
24 | TDE0049 | hypothetical protein | TDE0050 | RNA methyltransferase, TrmH family | <-<- | 59180 | 59372 | 193 | 23.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
25 | TDE0051 | alcohol dehydrogenase, iron-containing | TDE0052 | flagellar biosynthetic protein FliQ | <--> | 61315 | 61444 | 130 | 29.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
26 | TDE0061 | fic family protein | TDE0062 | PTS system, IIA component | <--> | 69035 | 69229 | 195 | 27.7% | 0 | 0 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
27 | TDE0062 | PTS system, IIA component | TDE0063 | hypothetical protein | ->-> | 69722 | 69853 | 132 | 35.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
29 | TDE0067 | cyclic nucleotide-binding protein | TDE0068 | succinyl-diaminopimelate desuccinylase | <--> | 75279 | 75436 | 158 | 27.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
30 | TDE0069 | conserved hypothetical protein TIGR00238 | TDE0070 | RNA polymerase sigma-70 factor, region 2 family | ->-> | 77708 | 77852 | 145 | 22.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
31 | TDE0080 | betaine aldehyde dehydrogenase | TDE0081 | hypothetical protein | <-<- | 92303 | 92642 | 340 | 20.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
32 | TDE0084 | phosphoenolpyruvate-protein phosphotransferase | TDE0085 | ATP-dependent DNA helicase, UvrD/Rep family | <-<- | 97546 | 97685 | 140 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
33 | TDE0086 | hypothetical protein | TDE0087 | Trk system potassium uptake protein TrkA | <--> | 103967 | 104078 | 112 | 19.6% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
34 | TDE0095 | hypothetical protein | TDE0096 | NADH oxidase | ->-> | 112683 | 112862 | 180 | 31.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
35 | TDE0096 | NADH oxidase | TDE0097 | hypothetical protein | ->-> | 114198 | 114336 | 139 | 18% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
37 | TDE0107 | alpha-amylase family protein | TDE0108 | hypothetical protein | <--> | 128357 | 128538 | 182 | 25.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
38 | TDE0109 | phenylalanyl-tRNA synthetase alpha subunit | TDE0110 | M23/M37 peptidase domain protein | <--> | 130471 | 130720 | 250 | 24.4% | 0 | 0 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
39 | TDE0114 | iron-dependent transcriptional regulator | TDE0115 | hypothetical protein | <--> | 134091 | 134193 | 103 | 27.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
40 | TDE0119 | flagellar protein FliS | TDE0120 | hypothetical protein | <--> | 137589 | 137787 | 199 | 26.1% | 0 | 0 | 0 | +: 1/3/3 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
41 | TDE0126 | hypothetical protein | TDE0127 | DNA-binding protein | <--> | 145728 | 145889 | 162 | 24.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
42 | TDE0127 | DNA-binding protein | TDE0128 | HAMP domain/GGDEF domain/EAL domain protein | ->-> | 146205 | 146379 | 175 | 25.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
43 | TDE0129 | PyrBI protein | TDE0130 | sodium/dicarboxylate symporter family protein | <--> | 150390 | 150684 | 295 | 30.8% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
44 | TDE0132 | hypothetical protein | TDE0133 | transcriptional regulator, GntR family | ->-> | 152357 | 152512 | 156 | 36.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
45 | TDE0133 | transcriptional regulator, GntR family | TDE0134 | oxidoreductase, FAD-dependent | ->-> | 153263 | 153543 | 281 | 40.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
47 | TDE0146 | amidohydrolase family protein | TDE0147 | hypothetical protein | <-<- | 168728 | 168878 | 151 | 24.5% | 0 | 0 | 0 | +: 2/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
48 | TDE0155 | adenylate/guanylate cyclase catalytic domain protein | TDE0156 | adenylate/guanylate cyclase catalytic domain protein | <-<- | 180245 | 180433 | 189 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
49 | TDE0156 | adenylate/guanylate cyclase catalytic domain protein | TDE0157 | KHG/KDPG family aldolase/carbohydrate kinase, PfkB family | <--> | 183662 | 183998 | 337 | 26.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
50 | TDE0158 | hypothetical protein | TDE0160 | hypothetical protein | <-<- | 186039 | 187234 | 1196 | 30.4% | 0 | 0 | 14 | +: 0/1/0 | -: 4/1/0 | 1 | 0 | 0 | 0 | Result | |
51 | TDE0161 | hypothetical protein | TDE0162 | hypothetical protein | <--> | 187920 | 188037 | 118 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
52 | TDE0164 | hypothetical protein | TDE0165 | hypothetical protein | <--> | 194089 | 194261 | 173 | 19.7% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
54 | TDE0178 | methyl-accepting chemotaxis protein | TDE0179 | hypothetical protein | <-<- | 212719 | 212860 | 142 | 43% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
55 | TDE0183 | ABC transporter, permease protein | TDE0184 | ABC transporter, ATP-binding protein | <--> | 218682 | 218887 | 206 | 27.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
56 | TDE0186 | hypothetical protein | TDE0187 | carboxylesterase, putative | <--> | 223789 | 223984 | 196 | 23% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
57 | TDE0187 | carboxylesterase, putative | TDE0188 | adenosine deaminase | ->-> | 224753 | 224860 | 108 | 22.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
58 | TDE0193 | hypothetical protein | TDE0194 | hypothetical protein | <-<- | 230680 | 230828 | 149 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
59 | TDE0195 | acetyltransferase, GNAT family | TDE0196 | hypothetical protein | <--> | 232602 | 232710 | 109 | 28.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
60 | TDE0201 | hypothetical protein | TDE0202 | hypothetical protein | -><- | 235785 | 235959 | 175 | 39.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
61 | TDE0206 | surface antigen, putative | TDE0207 | permease, GntP family | <--> | 241618 | 241741 | 124 | 24.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
62 | TDE0210 | cob(I)yrinic acid a,c-diamide adenosyltransferase | TDE0211 | ABC transporter, permease protein, cysTW family | -><- | 246207 | 246644 | 438 | 45.9% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
65 | TDE0226 | hypothetical protein | TDE0227 | adenine-specific DNA modification methyltransferase | <--> | 256784 | 257075 | 292 | 16.8% | 0 | 0 | 0 | +: 3/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
66 | TDE0228 | hypothetical protein | TDE0229 | ATPase family protein | <-<- | 260694 | 260955 | 262 | 19.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
67 | TDE0231 | DNA polymerase III, beta subunit | TDE0232 | appr-1-p processing enzyme domain protein | <--> | 265084 | 265353 | 270 | 20.4% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
68 | TDE0233 | fic family protein | TDE0234 | ABC transporter, ATP-binding protein, HlyB family | <--> | 267011 | 267192 | 182 | 22% | 0 | 0 | 0 | +: 0/0/0 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
69 | TDE0237 | HDIG domain protein | TDE0238 | thioredoxin, selenocysteine-containing | <--> | 271281 | 271519 | 239 | 30.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
70 | TDE0240 | glycine reductase complex protein GrdC | TDE0241 | hypothetical protein | <-<- | 274624 | 274790 | 167 | 23.4% | 0 | 0 | 0 | +: 1/0/0 | -: 3/0/0 | 1 | 0 | 0 | 0 | Result | |
71 | TDE0245 | ABC transporter, ATP-binding/permease protein | TDE0246 | transcriptional regulator, TetR family | <-<- | 281034 | 281185 | 152 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
72 | TDE0246 | transcriptional regulator, TetR family | TDE0248 | hypothetical protein | <--> | 281756 | 282207 | 452 | 37.4% | 0 | 0 | 189 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
73 | TDE0248 | hypothetical protein | TDE0249 | flavoredoxin, putative | ->-> | 282577 | 282678 | 102 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
74 | TDE0249 | flavoredoxin, putative | TDE0250 | sodium-dependent transporter, putative | -><- | 283243 | 283399 | 157 | 33.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
75 | TDE0251 | tryptophanase | TDE0252 | hypothetical protein | <--> | 286187 | 286402 | 216 | 28.2% | 0 | 0 | 0 | +: 1/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
76 | TDE0258 | methlytransferase, UbiE/COQ5 family | TDE0259 | transcriptional regulator, MarR family | <--> | 292975 | 293396 | 422 | 30.6% | 0 | 0 | 0 | +: 2/2/0 | -: 2/2/2 | 1 | 0 | 0 | 0 | Result | |
77 | TDE0264 | ribbon-helix-helix protein, CopG family | TDE0266 | hypothetical protein | <-<- | 297378 | 297856 | 479 | 29.6% | 0 | 0 | 8 | +: 1/0/0 | -: 2/1/2 | 1 | 0 | 0 | 0 | Result | |
78 | TDE0267 | HAM1 protein | TDE0268 | hypothetical protein | <-<- | 299199 | 299308 | 110 | 44.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
79 | TDE0268 | hypothetical protein | TDE0269 | hypothetical protein | <-<- | 300140 | 300285 | 146 | 42.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
80 | TDE0269 | hypothetical protein | TDE0270 | hypothetical protein | <-<- | 300778 | 300934 | 157 | 26.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
82 | TDE0274 | ABC transporter, ATP-binding/permease protein | TDE0275 | CAAX amino terminal protease family protein | <--> | 306514 | 306772 | 259 | 24.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
83 | TDE0279 | hypothetical protein | TDE0280 | PIN domain protein | <-<- | 309873 | 309984 | 112 | 44.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
84 | TDE0281 | hypothetical protein | TDE0282 | ABC transporter, ATP-binding protein | <-<- | 310581 | 310744 | 164 | 34.1% | 0 | 0 | 0 | +: 0/2/0 | -: 2/4/0 | 1 | 0 | 0 | 0 | Result | |
85 | TDE0284 | hypothetical protein | TDE0285 | translation elongation factor G | <--> | 313519 | 313761 | 243 | 27.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
86 | TDE0291 | hypothetical protein | TDE0292 | hypothetical protein | <-<- | 321151 | 321264 | 114 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
87 | TDE0295 | DNA gyrase, A subunit | TDE0296 | formiminotransferase, putative | <-<- | 326758 | 326931 | 174 | 35.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
88 | TDE0298 | hypothetical protein | TDE0299 | mutator mutT protein | ->-> | 330062 | 330219 | 158 | 24.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
89 | TDE0299 | mutator mutT protein | TDE0300 | leucyl aminopeptidase | ->-> | 330640 | 330982 | 343 | 26.8% | 0 | 0 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
90 | TDE0303 | hypothetical protein | TDE0304 | hypothetical protein | ->-> | 333920 | 334022 | 103 | 27.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
91 | TDE0304 | hypothetical protein | TDE0305 | GTP-binding protein YchF | -><- | 335553 | 335734 | 182 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
93 | TDE0316 | ABC transporter, ATP-binding/permease protein | TDE0317 | hypothetical protein | <--> | 350550 | 350795 | 246 | 19.5% | 0 | 0 | 0 | +: 3/1/1 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
95 | TDE0323 | hypothetical protein | TDE0324 | hypothetical protein | <--> | 357286 | 357583 | 298 | 20.1% | 0 | 0 | 0 | +: 1/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
96 | TDE0326 | ATP-dependent DNA helicase RecQ | TDE0327 | CRISPR-associated SAG0894 family protein | <--> | 360719 | 361020 | 302 | 30.8% | 0 | 0 | 0 | +: 1/1/0 | -: 2/1/1 | 1 | 0 | 0 | 0 | Result | |
98 | TDE0333 | MATE efflux family protein | TDE0334 | hypothetical protein | -><- | 373144 | 373385 | 242 | 43.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 5 | 0 | 0 | 0 | Result | |
99 | TDE0337 | glucosamine-6-phosphate deaminase | TDE0338 | methyl-accepting chemotaxis protein-like protein | <--> | 377198 | 377456 | 259 | 23.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
100 | TDE0339 | transcriptional regulator, TetR family | TDE0340 | fructose-bisphosphate aldolase | ->-> | 378629 | 378778 | 150 | 27.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
101 | TDE0342 | integral membrane protein MviN | TDE0343 | hydrolase, alpha/beta fold family | <-<- | 383832 | 384336 | 505 | 36.8% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
102 | TDE0344 | transcriptional regulator, AbrB family | TDE0345 | methyl-accepting chemotaxis protein DmcB | <-<- | 385679 | 385833 | 155 | 32.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
103 | TDE0346 | protease PrtB | TDE0347 | methyl-accepting chemotaxis protein DmcA | <-<- | 387988 | 388139 | 152 | 30.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
104 | TDE0347 | methyl-accepting chemotaxis protein DmcA | TDE0348 | transcriptional regulator, TetR family | <--> | 390330 | 390596 | 267 | 28.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
105 | TDE0351 | L-lactate dehydrogenase | TDE0352 | ribose 5-phosphate isomerase B | <--> | 396089 | 396346 | 258 | 31.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
106 | TDE0355 | hypothetical protein | TDE0356 | hypothetical protein | -><- | 399718 | 399821 | 104 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
107 | TDE0358 | cinnamoyl ester hydrolase | TDE0359 | ABC transporter, ATP-binding/permease protein | <-<- | 401729 | 402282 | 554 | 38.6% | 0 | 0 | 2 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
108 | TDE0360 | ABC transporter, ATP-binding/permease protein | TDE0361 | transporter, putative | <--> | 405935 | 406128 | 194 | 33.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
109 | TDE0364 | ABC transporter, ATP-binding protein | TDE0365 | hypothetical protein | <-<- | 411696 | 411812 | 117 | 26.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
110 | TDE0368 | type I restriction-modification system, S subunit, putative | TDE0369 | type I restriction-modification system, M subunit | <-<- | 418336 | 418445 | 110 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
111 | TDE0369 | type I restriction-modification system, M subunit | TDE0370 | UDP-N-acetylmuramoylalanine--D-glutamate ligase | <--> | 421062 | 421223 | 162 | 24.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
112 | TDE0370 | UDP-N-acetylmuramoylalanine--D-glutamate ligase | TDE0371 | hypothetical protein | ->-> | 422655 | 422826 | 172 | 41.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
113 | TDE0373 | ABC transporter, ATP-binding/permease protein | TDE0374 | glycosyl transferase, group 1 family protein | <-<- | 427813 | 428003 | 191 | 24.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
114 | TDE0377 | hypothetical protein | TDE0378 | hypothetical protein | <--> | 432068 | 432303 | 236 | 24.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
115 | TDE0386 | ABC transporter, periplasmic substrate-binding protein | TDE0387 | (R)-hydroxyglutaryl-CoA dehydratase activator | <--> | 438412 | 438566 | 155 | 23.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
116 | TDE0392 | (R)-2-hydroxyglutaryl-CoA dehydratase, beta subunit, putative | TDE0393 | transcriptional regulator, TetR family | <-<- | 443115 | 443271 | 157 | 20.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
117 | TDE0393 | transcriptional regulator, TetR family | TDE0394 | oligopeptide/dipeptide ABC transporter, permease protein | <--> | 443920 | 444120 | 201 | 25.9% | 0 | 0 | 0 | +: 1/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
118 | TDE0402 | hypothetical protein | TDE0403 | hypothetical protein | <--> | 454443 | 454572 | 130 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
119 | TDE0405 | major outer sheath protein | TDE0406 | hypothetical protein | ->-> | 457242 | 457369 | 128 | 37.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
120 | TDE0406 | hypothetical protein | TDE0407 | glutamate synthase (NADPH), homotetrameric | -><- | 458990 | 459100 | 111 | 28.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
121 | TDE0408 | oxidoreductase, NAD-binding | TDE0409 | hypothetical protein | <--> | 461463 | 461716 | 254 | 28.7% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
122 | TDE0414 | hypothetical protein | TDE0415 | lipoprotein, putative | ->-> | 467703 | 467806 | 104 | 23.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
123 | TDE0418 | lipoprotein, putative | TDE0419 | hypothetical protein | ->-> | 470954 | 471062 | 109 | 22.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
124 | TDE0431 | LysM domain protein | TDE0432 | TPR domain protein, truncation | <-<- | 487685 | 487809 | 125 | 24% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
126 | TDE0433 | hypothetical protein | TDE0434 | rubrerythrin | <--> | 488808 | 489048 | 241 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
127 | TDE0438 | queuine tRNA-ribosyltransferase | TDE0439 | hypothetical protein | <-<- | 494902 | 495193 | 292 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
128 | TDE0439 | hypothetical protein | TDE0440 | DNA-binding protein | <--> | 495914 | 496090 | 177 | 24.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
129 | TDE0442 | hypothetical protein | TDE0443 | hypothetical protein | <--> | 497814 | 498077 | 264 | 28.4% | 0 | 0 | 0 | +: 2/1/2 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
130 | TDE0445 | amino acid permease | TDE0446 | fibronectin type III domain protein | ->-> | 501165 | 501408 | 244 | 30.7% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
131 | TDE0450 | hypothetical protein | TDE0451 | arginine deiminase | <--> | 508620 | 508792 | 173 | 32.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
132 | TDE0456 | pyridoxine biosynthesis protein | TDE0457 | hypothetical protein | <--> | 513475 | 513664 | 190 | 32.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
133 | TDE0458 | hypothetical protein | TDE0459 | hypothetical protein | ->-> | 514281 | 514521 | 241 | 26.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
134 | TDE0462 | metallo-beta-lactamase family protein | TDE0463 | purine nucleoside phosphorylase | <--> | 517078 | 517322 | 245 | 30.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
135 | TDE0466 | hypothetical protein | TDE0467 | hypothetical protein | <-<- | 518945 | 519095 | 151 | 32.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
136 | TDE0469 | hypothetical protein | TDE0470 | cell division protein FtsH | <--> | 524078 | 524640 | 563 | 33.4% | 0 | 0 | 0 | +: 2/2/4 | -: 1/1/1 | 3 | 0 | 0 | 0 | Result | |
137 | TDE0470 | cell division protein FtsH | TDE0471 | BNR domain protein | -><- | 526618 | 526746 | 129 | 44.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
138 | TDE0471 | BNR domain protein | TDE0472 | hypothetical protein | <--> | 528379 | 528515 | 137 | 25.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
139 | TDE0484 | methyl-accepting chemotaxis protein | TDE0485 | hypothetical protein | <-<- | 541907 | 542095 | 189 | 20.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
140 | TDE0489 | hypothetical protein | TDE0490 | hypothetical protein | <-<- | 546146 | 546361 | 216 | 24.1% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
141 | TDE0493 | hypothetical protein | TDE0494 | hypothetical protein | <-<- | 549433 | 549648 | 216 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
142 | TDE0495 | hypothetical protein | TDE0496 | DNA-binding protein, putative | <-<- | 550932 | 551060 | 129 | 41.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
143 | TDE0496 | DNA-binding protein, putative | TDE0497 | hypothetical protein | <-<- | 551280 | 551463 | 184 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
144 | TDE0498 | hypothetical protein | TDE0499 | hypothetical protein | <-<- | 552334 | 552606 | 273 | 30.8% | 0 | 0 | 6 | +: 0/2/0 | -: 2/3/0 | 1 | 0 | 0 | 0 | Result | |
145 | TDE0500 | hypothetical protein | TDE0501 | hypothetical protein | <-<- | 553777 | 554274 | 498 | 32.9% | 0 | 0 | 0 | +: 1/1/1 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
146 | TDE0501 | hypothetical protein | TDE0502 | ankyrin repeat protein | <-<- | 555403 | 555583 | 181 | 29.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
147 | TDE0513 | hypothetical protein | TDE0514 | hypothetical protein | <-<- | 562332 | 562509 | 178 | 29.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
148 | TDE0518 | hypothetical protein | TDE0519 | hypothetical protein | <-<- | 565354 | 565527 | 174 | 40.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
149 | TDE0521 | carboxylesterase family protein | TDE0522 | hypothetical protein | <--> | 568343 | 568638 | 296 | 32.4% | 0 | 0 | 2 | +: 1/4/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
150 | TDE0523 | hypothetical protein | TDE0524 | hypothetical protein | <--> | 569922 | 570156 | 235 | 32.3% | 0 | 0 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
151 | TDE0525 | hypothetical protein | TDE0526 | hypothetical protein | ->-> | 571224 | 571580 | 357 | 33.1% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
152 | TDE0527 | hypothetical protein | TDE0528 | hypothetical protein | ->-> | 573222 | 573345 | 124 | 22.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
153 | TDE0536 | hypothetical protein | TDE0537 | hypothetical protein | <--> | 578955 | 579163 | 209 | 26.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
154 | TDE0546 | hypothetical protein | TDE0547 | hypothetical protein | -><- | 585880 | 586060 | 181 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
156 | TDE0559 | hypothetical protein | TDE0560 | hypothetical protein | ->-> | 594187 | 594301 | 115 | 32.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
158 | TDE0562 | hypothetical protein | TDE0563 | hypothetical protein | ->-> | 595642 | 595871 | 230 | 38.3% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
159 | TDE0568 | hypothetical protein | TDE0569 | hypothetical protein | ->-> | 599289 | 599775 | 487 | 41.7% | 0 | 0 | 0 | +: 1/3/3 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
160 | TDE0570 | hypothetical protein | TDE0571 | hypothetical protein | ->-> | 601017 | 601274 | 258 | 42.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
161 | TDE0574 | surface protein, putative | TDE0575 | aspartyl/glutamyl-tRNA amidotransferase subunit B | -><- | 605923 | 606341 | 419 | 39.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
162 | TDE0578 | hypothetical protein | TDE0579 | hypothetical protein | -><- | 609738 | 609987 | 250 | 32.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 2 | 0 | 0 | 0 | Result | |
167 | TDE0585 | hypothetical protein | TDE0586 | hypothetical protein | <--> | 625115 | 625385 | 271 | 24% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
168 | TDE0586 | hypothetical protein | TDE0587 | hypothetical protein | ->-> | 625701 | 625888 | 188 | 25% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
170 | TDE0590 | acetyl-CoA carboxylase, carboxyl transferase, beta subunit | TDE0591 | acetyl-CoA carboxylase, biotin carboxylase | <-<- | 629947 | 630122 | 176 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
171 | TDE0592 | acetyl-CoA carboxylase, biotin carboxyl carrier protein | TDE0593 | internalin-related protein | <-<- | 632029 | 632130 | 102 | 29.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
172 | TDE0597 | hypothetical protein | TDE0598 | 3-oxoacyl-(acyl-carrier-protein) reductase | <-<- | 637303 | 637447 | 145 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
173 | TDE0602 | 3-oxoacyl-(acyl-carrier-protein) synthase III | TDE0603 | hypothetical protein | <--> | 640862 | 641027 | 166 | 24.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
174 | TDE0607 | ParA family ATPase | TDE0608 | DNA-binding protein, putative | <-<- | 644971 | 645083 | 113 | 18.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
175 | TDE0608 | DNA-binding protein, putative | TDE0609 | hypothetical protein | <-<- | 645258 | 645365 | 108 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
176 | TDE0609 | hypothetical protein | TDE0610 | 3-hydroxyacyl-CoA dehydrogenase, putative | <-<- | 646257 | 646446 | 190 | 33.2% | 0 | 0 | 0 | +: 1/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
178 | TDE0622 | radical SAM domain protein | TDE0623 | precorrin-3B C17-methyltransferase | <--> | 655809 | 655922 | 114 | 25.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
179 | TDE0626 | hypothetical protein | TDE0627 | co-chaperone protein GrpE | ->-> | 659745 | 659984 | 240 | 34.2% | 0 | 0 | 0 | +: 2/2/4 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
180 | TDE0639 | oligopeptide/dipeptide ABC transporter, permease protein | TDE0640 | methyl-accepting chemotaxis protein | <-<- | 674485 | 674620 | 136 | 30.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
181 | TDE0640 | methyl-accepting chemotaxis protein | TDE0641 | UDP-N-acetylglucosamine 1-carboxyvinyltransferase | <-<- | 676856 | 677091 | 236 | 22.9% | 0 | 0 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
183 | TDE0646 | hypothetical protein | TDE0647 | chemotaxis protein methyltransferase | <--> | 681956 | 682083 | 128 | 28.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
185 | TDE0650 | hypothetical protein | TDE0652 | hypothetical protein | ->-> | 685872 | 688316 | 2445 | 42.5% | 0 | 0 | 249 | +: 1/6/6 | -: 2/2/2 | 1 | 0 | 0 | 0 | Result | |
186 | TDE0654 | peptidase, M20/M25/M40 family | TDE0655 | response regulator | ->-> | 690919 | 691060 | 142 | 23.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
187 | TDE0663 | hypothetical protein | TDE0664 | OmpA family protein | <--> | 698188 | 698519 | 332 | 23.5% | 0 | 0 | 0 | +: 0/4/0 | -: 2/3/4 | 1 | 0 | 0 | 0 | Result | |
188 | TDE0665 | pyruvate ferredoxin/flavodoxin oxidoreductase family protein | TDE0666 | FeS assembly ATPase SufC | <--> | 703443 | 703692 | 250 | 26.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
189 | TDE0669 | hypothetical protein | TDE0670 | ATP-dependent protease La | <--> | 707918 | 708077 | 160 | 21.9% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
190 | TDE0670 | ATP-dependent protease La | TDE0671 | PIN domain protein | ->-> | 710454 | 710760 | 307 | 30.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
191 | TDE0671 | PIN domain protein | TDE0672 | hypothetical protein | ->-> | 711139 | 711249 | 111 | 46.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
192 | TDE0673 | hypothetical protein | TDE0674 | hypothetical protein | ->-> | 713174 | 713300 | 127 | 37% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
195 | TDE0685 | oxidoreductase, short chain dehydrogenase/reductase family | TDE0686 | phosphoribosylaminoimidazole-succinocarboxamide synthase | <--> | 722711 | 722866 | 156 | 26.9% | 0 | 0 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
196 | TDE0692 | hypothetical protein | TDE0693 | phosphomethylpyrimidine kinase | ->-> | 729981 | 730081 | 101 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
197 | TDE0693 | phosphomethylpyrimidine kinase | TDE0694 | ABC transporter, ATP-binding protein | ->-> | 730892 | 731129 | 238 | 31.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
198 | TDE0697 | hypothetical protein | TDE0698 | PIN domain protein | <-<- | 734463 | 734711 | 249 | 35.3% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
199 | TDE0700 | hypothetical protein | TDE0701 | hypothetical protein | <-<- | 736489 | 736608 | 120 | 21.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
200 | TDE0703 | transcriptional regulator, AbrB family | TDE0704 | SPFH domain/Band 7 family protein | <-<- | 738281 | 738518 | 238 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
201 | TDE0705 | SPFH domain/Band 7 family protein | TDE0706 | adenine-specific DNA modification methyltransferase | <--> | 740359 | 740559 | 201 | 23.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
202 | TDE0712 | hypothetical protein | TDE0713 | transcription antitermination protein, NusG family | <--> | 747054 | 747248 | 195 | 30.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
203 | TDE0715 | hypothetical protein | TDE0716 | CAAX amino terminal protease family protein | ->-> | 750611 | 750967 | 357 | 35.3% | 0 | 0 | 0 | +: 1/3/3 | -: 0/2/0 | 5 | 0 | 0 | 0 | Result | |
205 | TDE0717 | hypothetical protein | TDE0718 | hypothetical protein | ->-> | 752441 | 753354 | 914 | 30.2% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
206 | TDE0721 | hypothetical protein | TDE0722 | lipoprotein, putative | ->-> | 758277 | 758658 | 382 | 35.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
207 | TDE0722 | lipoprotein, putative | TDE0723 | hypothetical protein | ->-> | 759925 | 760443 | 519 | 37.8% | 0 | 0 | 0 | +: 1/2/2 | -: 0/2/0 | 5 | 0 | 0 | 0 | Result | |
208 | TDE0723 | hypothetical protein | TDE0724 | hypothetical protein | ->-> | 761722 | 761992 | 271 | 35.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 5 | 0 | 0 | 0 | Result | |
209 | TDE0724 | hypothetical protein | TDE0725 | exopolysaccharide biosynthesis protein | ->-> | 763298 | 763604 | 307 | 35.5% | 0 | 0 | 0 | +: 1/2/2 | -: 0/1/0 | 5 | 0 | 0 | 0 | Result | |
210 | TDE0730 | hypothetical protein | TDE0731 | hypothetical protein | <-<- | 770678 | 770780 | 103 | 24.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
212 | TDE0736 | hypothetical protein | TDE0737 | hypothetical protein | <-<- | 775321 | 775497 | 177 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
213 | TDE0741 | hypothetical protein | TDE0742 | hypothetical protein | <-<- | 778249 | 778539 | 291 | 46.4% | 0 | 0 | 2 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
214 | TDE0742 | hypothetical protein | TDE0743 | thioredoxin reductase | <--> | 778726 | 778857 | 132 | 28% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
216 | TDE0744 | thioredoxin | TDE0745 | glycine reductase complex selenoprotein GrdA | ->-> | 780302 | 780426 | 125 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
217 | TDE0745 | glycine reductase complex selenoprotein GrdA | TDE0746 | iron compound ABC transporter, ATP-binding protein, putative | -><- | 780901 | 781020 | 120 | 45% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
218 | TDE0748 | iron compound ABC transporter, periplasmic iron compound-binding protein, putative | TDE0749 | cobalamin biosynthesis protein CobN, putative | <-<- | 784379 | 784562 | 184 | 27.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
219 | TDE0751 | magnesium chelatase, subunit D/I family | TDE0752 | hypothetical protein | <--> | 791142 | 791492 | 351 | 33.3% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
220 | TDE0758 | iron compound ABC transporter, periplasmic iron compound-binding protein, putative | TDE0759 | hypothetical protein | <-<- | 799014 | 799217 | 204 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
221 | TDE0761 | protease complex-associated polypeptide | TDE0763 | hypothetical protein | -><- | 802029 | 804323 | 2295 | 44.9% | 0 | 1 | 31 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
222 | TDE0764 | hypothetical protein | TDE0765 | translation elongation factor Tu | <--> | 804618 | 804871 | 254 | 37.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
223 | TDE0795 | hypothetical protein | TDE0796 | histidinol phosphate phosphatase HisJ family protein | <--> | 820065 | 820196 | 132 | 28.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
224 | TDE0798 | transporter, putative | TDE0799 | glycerophosphoryl diester phosphodiesterase, putative | <--> | 822648 | 822748 | 101 | 20.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
225 | TDE0801 | hypothetical protein | TDE0802 | hypothetical protein | <-<- | 824450 | 824561 | 112 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
226 | TDE0802 | hypothetical protein | TDE0803 | hypothetical protein | <--> | 825198 | 825456 | 259 | 24.3% | 0 | 0 | 0 | +: 1/4/4 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
227 | TDE0804 | hypothetical protein | TDE0805 | hypothetical protein | <--> | 828090 | 828310 | 221 | 32.6% | 0 | 0 | 0 | +: 0/3/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
228 | TDE0811 | efflux protein, putative | TDE0812 | ABC transporter, ATP-binding/permease protein | <--> | 832439 | 832583 | 145 | 29.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
229 | TDE0816 | peptidase, M20/M25/M40 family | TDE0817 | histidine kinase-related ATPase, putative | <--> | 838655 | 838939 | 285 | 24.9% | 0 | 0 | 0 | +: 2/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
230 | TDE0819 | ABC transporter, ATP-binding/permease protein | TDE0820 | transcriptional regulator, TetR family | <-<- | 843476 | 843803 | 328 | 39.9% | 0 | 0 | 0 | +: 1/1/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
231 | TDE0822 | hypothetical protein | TDE0823 | (3R)-hydroxymyristoyl-(acyl-carrier-protein) dehydratase, putative | ->-> | 844730 | 844880 | 151 | 27.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
232 | TDE0824 | lipoprotein, putative | TDE0825 | UDP-N-acetylmuramoylalanyl-D-glutamate-2, 6-diaminopimelate ligase, putative | <--> | 845967 | 846101 | 135 | 17.8% | 0 | 0 | 0 | +: 1/1/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
233 | TDE0827 | hypothetical protein | TDE0828 | glucose-inhibited division protein A | <-<- | 848144 | 848372 | 229 | 39.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
234 | TDE0829 | putative aminopeptidase 2 | TDE0830 | hypothetical protein | <-<- | 851568 | 851698 | 131 | 31.3% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
235 | TDE0831 | hypothetical protein | TDE0832 | hypothetical protein | <--> | 852386 | 852688 | 303 | 26.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
236 | TDE0833 | lipoprotein, putative | TDE0834 | Na(+)-translocating NADH-quinone reductase, E subunit | -><- | 854158 | 854380 | 223 | 41.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/6/0 | 2 | 0 | 0 | 0 | Result | |
237 | TDE0841 | hypothetical protein | TDE0842 | cytoplasmic filament protein A | <--> | 861689 | 861854 | 166 | 18.7% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
239 | TDE0845 | conserved hypothetical protein TIGR00266 | TDE0846 | hypothetical protein | ->-> | 868610 | 868762 | 153 | 38.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
240 | TDE0846 | hypothetical protein | TDE0847 | hypothetical protein | ->-> | 870926 | 871033 | 108 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
241 | TDE0848 | hypothetical protein | TDE0849 | hypothetical protein | ->-> | 871619 | 871738 | 120 | 36.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
242 | TDE0850 | methyl-accepting chemotaxis protein | TDE0851 | hypothetical protein | <-<- | 874636 | 874838 | 203 | 23.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
243 | TDE0861 | tyrosyl-tRNA synthetase | TDE0862 | hypothetical protein | <--> | 883189 | 883331 | 143 | 20.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
245 | TDE0869 | hypothetical protein | TDE0870 | phosphatase/nucleotidase | ->-> | 892723 | 892837 | 115 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
246 | TDE0876 | hypothetical protein | TDE0877 | hypothetical protein | <--> | 898615 | 898728 | 114 | 27.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
247 | TDE0877 | hypothetical protein | TDE0878 | hypothetical protein | ->-> | 899680 | 899791 | 112 | 26.8% | 0 | 0 | 0 | +: 2/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
248 | TDE0880 | nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase | TDE0881 | ribosomal protein S16 | ->-> | 901197 | 901306 | 110 | 32.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
249 | TDE0888 | hypothetical protein | TDE0889 | hypothetical protein | <--> | 905066 | 905229 | 164 | 28.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
250 | TDE0889 | hypothetical protein | TDE0890 | hypothetical protein | ->-> | 905875 | 906029 | 155 | 29.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
251 | TDE0895 | transcriptional regulator, AraC family | TDE0896 | ABC transporter, ATP-binding/permease protein | <--> | 912265 | 912465 | 201 | 24.4% | 0 | 0 | 0 | +: 1/1/1 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
252 | TDE0900 | ABC transporter, ATP-binding protein | TDE0901 | hypothetical protein | -><- | 918753 | 918948 | 196 | 24.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
253 | TDE0902 | hypothetical protein | TDE0903 | ATP-dependent DNA helicase PcrA | <--> | 920223 | 920367 | 145 | 30.3% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
254 | TDE0908 | ABC transporter, ATP-binding/permease protein | TDE0909 | type II DNA modification methyltransferase M.TdeIII | ->-> | 927146 | 927305 | 160 | 45% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
255 | TDE0911 | type II restriction endonuclease TdeIII | TDE0912 | hypothetical protein | ->-> | 931390 | 931489 | 100 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
256 | TDE0912 | hypothetical protein | TDE0913 | hypothetical protein | -><- | 931589 | 931785 | 197 | 27.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
257 | TDE0922 | ABC transporter, ATP-binding/permease protein | TDE0923 | ABC transporter, ATP-binding/permease protein | <-<- | 943731 | 944009 | 279 | 39.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
258 | TDE0924 | ABC transporter, ATP-binding/permease protein | TDE0925 | peptidase T | <--> | 947725 | 947986 | 262 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
260 | TDE0932 | adenylate/guanylate cyclase catalytic domain protein | TDE0933 | acetate kinase | <--> | 958035 | 958202 | 168 | 25% | 0 | 0 | 0 | +: 3/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
261 | TDE0935 | hypothetical protein | TDE0936 | hypothetical protein | <-<- | 959844 | 959961 | 118 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
262 | TDE0937 | RNA polymerase sigma-70 factor family protein | TDE0938 | hypothetical protein | -><- | 960952 | 961052 | 101 | 38.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
263 | TDE0942 | long-chain-fatty-acid--CoA ligase, putative | TDE0943 | hypothetical protein | ->-> | 966000 | 966122 | 123 | 35.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
264 | TDE0944 | hypothetical protein | TDE0945 | hypothetical protein | ->-> | 967098 | 967267 | 170 | 43.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
265 | TDE0947 | translation elongation factor G, putative | TDE0948 | hypothetical protein | <-<- | 970883 | 971048 | 166 | 28.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
266 | TDE0948 | hypothetical protein | TDE0949 | enolase | <--> | 971928 | 972149 | 222 | 30.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
267 | TDE0949 | enolase | TDE0950 | hypothetical protein | -><- | 973452 | 974255 | 804 | 27% | 0 | 0 | 0 | +: 2/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
268 | TDE0968 | translation elongation factor P | TDE0969 | hypothetical protein | <--> | 993217 | 993399 | 183 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
269 | TDE0969 | hypothetical protein | TDE0970 | hypothetical protein | ->-> | 994636 | 994908 | 273 | 38.5% | 0 | 0 | 0 | +: 0/5/0 | -: 0/3/0 | 5 | 0 | 0 | 0 | Result | |
270 | TDE0973 | DNA repair protein RadC | TDE0974 | hypothetical protein | <--> | 998708 | 998833 | 126 | 27% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
271 | TDE0974 | hypothetical protein | TDE0975 | hypothetical protein | ->-> | 998936 | 999060 | 125 | 35.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
272 | TDE0975 | hypothetical protein | TDE0976 | hypothetical protein | ->-> | 999940 | 1000165 | 226 | 47.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
273 | TDE0977 | hypothetical protein | TDE0978 | hypothetical protein | ->-> | 1001701 | 1002007 | 307 | 50.8% | 0 | 0 | 1 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
274 | TDE0978 | hypothetical protein | TDE0979 | penicillin binding protein | -><- | 1002485 | 1002599 | 115 | 32.2% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
275 | TDE0980 | asparaginyl-tRNA synthetase | TDE0981 | hypothetical protein | <--> | 1005491 | 1005635 | 145 | 25.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
276 | TDE0982 | dihydroorotate dehydrogenase/oxidoreductase, FAD-binding | TDE0984 | oligopeptide/dipeptide ABC transporter, permease protein, putative | ->-> | 1008393 | 1009613 | 1221 | 37.8% | 0 | 7 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
277 | TDE0988 | oligopeptide/dipeptide ABC transporter, peptide-binding protein | TDE0989 | hypothetical protein | ->-> | 1017166 | 1017271 | 106 | 24.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
279 | TDE0993 | lipoprotein, putative | TDE0994 | hypothetical protein | <--> | 1020506 | 1020677 | 172 | 26.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
280 | TDE0998 | hypothetical protein | TDE0999 | formate/nitrite transporter | ->-> | 1025555 | 1026009 | 455 | 38% | 0 | 0 | 0 | +: 1/1/1 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
281 | TDE1004 | flagellar filament core protein | TDE1005 | hypothetical protein | <--> | 1030227 | 1030345 | 119 | 44.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
282 | TDE1008 | flagellar protein, putative | TDE1009 | methyl-accepting chemotaxis protein | -><- | 1032867 | 1033092 | 226 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
283 | TDE1009 | methyl-accepting chemotaxis protein | TDE1010 | excinuclease ABC, A subunit | <--> | 1035187 | 1035366 | 180 | 23.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
287 | TDE1024 | conserved hypothetical protein TIGR01319 | TDE1025 | ribosomal protein L32 | ->-> | 1057095 | 1057240 | 146 | 31.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
288 | TDE1027 | ribonuclease III | TDE1028 | hypothetical protein | ->-> | 1058443 | 1058583 | 141 | 20.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
289 | TDE1038 | hypothetical protein | TDE1039 | riboflavin biosynthesis protein, putative | <--> | 1067067 | 1067211 | 145 | 29% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
290 | TDE1040 | ribosomal protein S15 | TDE1041 | polyribonucleotide nucleotidyltransferase | ->-> | 1068349 | 1068463 | 115 | 28.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
291 | TDE1046 | hypothetical protein | TDE1047 | 30S ribosomal protein S12 | ->-> | 1074137 | 1074236 | 100 | 32% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
292 | TDE1048 | 30S ribosomal protein S7 | TDE1049 | elongation factor EF-2 | ->-> | 1075093 | 1075426 | 334 | 33.8% | 0 | 0 | 0 | +: 1/4/0 | -: 1/6/0 | 1 | 0 | 0 | 0 | Result | |
293 | TDE1051 | hypothetical protein | TDE1052 | rubredoxin | <-<- | 1078587 | 1078801 | 215 | 46% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 3 | 0 | 0 | 0 | Result | |
294 | TDE1053 | lipoprotein, putative | TDE1054 | methyl-accepting chemotaxis protein | <--> | 1080817 | 1080979 | 163 | 17.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
295 | TDE1055 | MATE efflux family protein | TDE1056 | hypothetical protein | <--> | 1084422 | 1085349 | 928 | 40.3% | 0 | 0 | 9 | +: 3/3/0 | -: 2/7/14 | 2 | 0 | 0 | 0 | Result | |
296 | TDE1056 | hypothetical protein | TDE1057 | hypothetical protein | -><- | 1085956 | 1086194 | 239 | 31.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
297 | TDE1058 | hypothetical protein | TDE1059 | hypothetical protein | <-<- | 1086457 | 1086587 | 131 | 50.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
298 | TDE1065 | hypothetical protein | TDE1066 | hypothetical protein | <-<- | 1094242 | 1094424 | 183 | 27.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
299 | TDE1071 | peptide ABC transporter, peptide-binding protein OppA | TDE1072 | lipoprotein, putative | <--> | 1100679 | 1100880 | 202 | 23.8% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
300 | TDE1072 | lipoprotein, putative | TDE1073 | oligopeptide/dipeptide ABC transporter, permease protein | ->-> | 1103497 | 1103654 | 158 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
301 | TDE1076 | oligopeptide/dipeptide ABC transporter, ATP-binding protein | TDE1077 | hypothetical protein | ->-> | 1108117 | 1108534 | 418 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
302 | TDE1077 | hypothetical protein | TDE1078 | metallo-beta-lactamase family protein | ->-> | 1109741 | 1109878 | 138 | 31.9% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
303 | TDE1078 | metallo-beta-lactamase family protein | TDE1079 | DNA-binding protein/PTS system, IIA component | ->-> | 1111106 | 1111259 | 154 | 29.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
304 | TDE1089 | hypothetical protein | TDE1090 | threonyl-tRNA synthetase | <--> | 1121035 | 1121245 | 211 | 27% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
305 | TDE1090 | threonyl-tRNA synthetase | TDE1091 | hypothetical protein | -><- | 1123004 | 1123106 | 103 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
306 | TDE1092 | hypothetical protein | TDE1093 | hypothetical protein | <--> | 1127256 | 1127513 | 258 | 34.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
307 | TDE1094 | hypothetical protein | TDE1095 | alanine racemase | ->-> | 1129783 | 1129965 | 183 | 36.6% | 0 | 0 | 0 | +: 1/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
308 | TDE1101 | acetyltransferase, GNAT family | TDE1102 | hypothetical protein | <-<- | 1135233 | 1135353 | 121 | 29.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
309 | TDE1102 | hypothetical protein | TDE1103 | hypothetical protein | <--> | 1136266 | 1136499 | 234 | 26.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
310 | TDE1108 | hypothetical protein | TDE1109 | decarboxylase, pyridoxal-dependent family | <--> | 1142950 | 1143219 | 270 | 28.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
311 | TDE1112 | adenylate kinase | TDE1113 | hypothetical protein | -><- | 1147688 | 1147818 | 131 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
312 | TDE1114 | transcriptional regulator, TetR family | TDE1115 | DNA-binding protein, putative | <-<- | 1148996 | 1149127 | 132 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
313 | TDE1118 | tyrosine phenol-lyase | TDE1119 | hypothetical protein | <--> | 1151352 | 1151466 | 115 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
314 | TDE1132 | chorismate synthase | TDE1133 | hypothetical protein | -><- | 1164641 | 1164842 | 202 | 27.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
316 | TDE1139 | hypothetical protein | TDE1140 | hypothetical protein | <-<- | 1168706 | 1168819 | 114 | 48.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
317 | TDE1146 | hypothetical protein | TDE1147 | hypothetical protein | <-<- | 1185505 | 1185618 | 114 | 29.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
318 | TDE1155 | hypothetical protein | TDE1156 | hypothetical protein | <-<- | 1191546 | 1191710 | 165 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
320 | TDE1157 | phage terminase, large subunit, putative | TDE1158 | phage terminase, small subunit, putative | <-<- | 1193384 | 1193502 | 119 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
323 | TDE1174 | hypothetical protein | TDE1175 | chaperonin GroEL | <-<- | 1203491 | 1203606 | 116 | 20.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
324 | TDE1175 | chaperonin GroEL | TDE1176 | oxygen-independent coproporphyrinogen III oxidase, putative | <-<- | 1205242 | 1205371 | 130 | 33.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
325 | TDE1180 | iron compound ABC transporter, periplasmic iron compound-binding protein | TDE1181 | methyltransferase domain protein | <--> | 1209924 | 1210031 | 108 | 25.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
326 | TDE1184 | hypothetical protein | TDE1185 | lipoprotein, putative | -><- | 1211582 | 1211686 | 105 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
327 | TDE1186 | hypothetical protein | TDE1187 | hypothetical protein | <--> | 1213576 | 1213727 | 152 | 30.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
328 | TDE1188 | NAD(P) transhydrogenase, beta subunit | TDE1190 | hypothetical protein | <--> | 1216713 | 1218362 | 1650 | 41.7% | 0 | 1 | 0 | +: 2/0/0 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
329 | TDE1191 | hypothetical protein | TDE1192 | hypothetical protein | ->-> | 1219279 | 1219471 | 193 | 32.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 2 | 0 | 0 | 0 | Result | |
334 | TDE1204 | cell division protein FtsZ | TDE1205 | integrase/recombinase XerD | ->-> | 1237727 | 1237828 | 102 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
335 | TDE1231 | hypothetical protein | TDE1232 | hypothetical protein | <-<- | 1265294 | 1265442 | 149 | 27.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
336 | TDE1232 | hypothetical protein | TDE1233 | hypothetical protein | <--> | 1267123 | 1267342 | 220 | 45.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
337 | TDE1234 | hypothetical protein | TDE1235 | hypothetical protein | <--> | 1269407 | 1269515 | 109 | 31.2% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
338 | TDE1236 | triosephosphate isomerase | TDE1237 | hypothetical protein | ->-> | 1270379 | 1270507 | 129 | 26.4% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
339 | TDE1245 | hypothetical protein | TDE1246 | lipoprotein, putative | <--> | 1278985 | 1279178 | 194 | 32.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
340 | TDE1247 | hypothetical protein | TDE1248 | hypothetical protein | ->-> | 1282486 | 1282735 | 250 | 44.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
341 | TDE1259 | amino acid carrier family protein | TDE1260 | cholinephosphate cytidylyltransferase/choline kinase | <--> | 1293761 | 1294167 | 407 | 29.7% | 0 | 0 | 1 | +: 1/0/0 | -: 3/1/2 | 1 | 0 | 0 | 0 | Result | |
342 | TDE1276 | hypothetical protein | TDE1277 | Fe-hydrogenase large subunit family protein | <--> | 1310710 | 1310820 | 111 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
343 | TDE1279 | phosphoribosylformylglycinamidine synthase II | TDE1280 | hypothetical protein | <-<- | 1315206 | 1315839 | 634 | 38.6% | 0 | 0 | 6 | +: 3/2/2 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
344 | TDE1287 | transcription-repair coupling factor | TDE1288 | CAAX amino terminal protease family protein | ->-> | 1326346 | 1326456 | 111 | 32.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
345 | TDE1288 | CAAX amino terminal protease family protein | TDE1289 | hypothetical protein | ->-> | 1327336 | 1327453 | 118 | 17.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
346 | TDE1291 | HD domain protein | TDE1292 | TldD/PmbA family protein | <-<- | 1329304 | 1329403 | 100 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
347 | TDE1294 | phosphocarrier protein HPr | TDE1296 | ribosomal subunit interface protein, putative | <-<- | 1332412 | 1333553 | 1142 | 39.2% | 0 | 0 | 117 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
348 | TDE1296 | ribosomal subunit interface protein, putative | TDE1297 | LysM domain/M23/M37 peptidase domain protein | <-<- | 1333845 | 1333966 | 122 | 29.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
349 | TDE1298 | cyclic nucleotide binding domain protein | TDE1299 | hypothetical protein | <-<- | 1335406 | 1335506 | 101 | 37.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
350 | TDE1304 | hypothetical protein | TDE1305 | DNA-binding protein | ->-> | 1340009 | 1340239 | 231 | 34.6% | 0 | 0 | 1 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
351 | TDE1306 | hypothetical protein | TDE1307 | hypothetical protein | <--> | 1340965 | 1341093 | 129 | 29.5% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
352 | TDE1310 | modulator of DNA gyrase family protein | TDE1311 | ABC transporter, ATP-binding/permease protein | ->-> | 1347401 | 1347510 | 110 | 39.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
353 | TDE1311 | ABC transporter, ATP-binding/permease protein | TDE1312 | hypothetical protein | ->-> | 1349116 | 1349227 | 112 | 33.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
354 | TDE1328 | hypothetical protein | TDE1329 | ATPase, AAA family | <--> | 1363493 | 1363642 | 150 | 24% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
355 | TDE1329 | ATPase, AAA family | TDE1330 | conserved hypothetical protein TIGR00244 | ->-> | 1365407 | 1365518 | 112 | 38.4% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
356 | TDE1337 | hypothetical protein | TDE1338 | 4-diphosphocytidyl-2C-methyl-D-erythritol kinase | <--> | 1374897 | 1375028 | 132 | 25.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
357 | TDE1340 | ribosomal 5S rRNA E-loop binding protein Ctc/L25/TL5 | TDE1341 | hypothetical protein | ->-> | 1377093 | 1377202 | 110 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
358 | TDE1343 | trypsin domain/PDZ domain protein | TDE1344 | hypothetical protein | ->-> | 1382297 | 1382531 | 235 | 25.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
359 | TDE1344 | hypothetical protein | TDE1345 | DNA primase | ->-> | 1383411 | 1383578 | 168 | 38.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
360 | TDE1347 | hypothetical protein | TDE1348 | TPR domain protein | ->-> | 1388093 | 1388472 | 380 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
361 | TDE1359 | hypothetical protein | TDE1360 | xanthine/uracil permease family protein | <--> | 1399255 | 1399436 | 182 | 19.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
362 | TDE1363 | nitroreductase family protein | TDE1364 | valyl-tRNA synthetase | <--> | 1404726 | 1404902 | 177 | 29.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
363 | TDE1364 | valyl-tRNA synthetase | TDE1365 | transcriptional regulator, TetR family | ->-> | 1407633 | 1407894 | 262 | 28.2% | 0 | 0 | 0 | +: 1/2/2 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
364 | TDE1372 | hypothetical protein | TDE1373 | HD domain protein | <-<- | 1416988 | 1417268 | 281 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
365 | TDE1374 | hypothetical protein | TDE1375 | pantetheine-phosphate adenylyltransferase | <--> | 1418089 | 1418220 | 132 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
366 | TDE1381 | V-type ATP synthase subunit E | TDE1382 | transcriptional regulator, ArsR family | <--> | 1421996 | 1422139 | 144 | 23.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
367 | TDE1401 | DedA family protein | TDE1402 | hypothetical protein | ->-> | 1443129 | 1443297 | 169 | 25.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
368 | TDE1407 | hypothetical protein | TDE1408 | flagellar filament outer layer protein FlaA, putative | <--> | 1450762 | 1450968 | 207 | 26.6% | 0 | 0 | 0 | +: 2/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
369 | TDE1409 | flagellar filament outer layer protein FlaA, putative | TDE1410 | hypothetical protein | -><- | 1452442 | 1452563 | 122 | 25.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
370 | TDE1411 | hypothetical protein | TDE1412 | sodium/hydrogen exchanger family protein | <--> | 1453493 | 1453601 | 109 | 27.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
371 | TDE1412 | sodium/hydrogen exchanger family protein | TDE1413 | cytidylyltransferase/phosphoenolpyruvate phosphomutase, putative | ->-> | 1455327 | 1455649 | 323 | 29.7% | 0 | 0 | 0 | +: 1/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
372 | TDE1455 | prevent-host-death family protein | TDE1456 | GGDEF domain protein | -><- | 1503272 | 1503401 | 130 | 27.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
374 | TDE1470 | hypothetical protein | TDE1471 | hypothetical protein | <-<- | 1518117 | 1518234 | 118 | 46.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
375 | TDE1473 | flagellin FlaG, putative | TDE1474 | hypothetical protein | <-<- | 1521222 | 1521350 | 129 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
376 | TDE1477 | flagellar filament core protein | TDE1478 | hypothetical protein | <-<- | 1523424 | 1523564 | 141 | 29.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
377 | TDE1480 | hypothetical protein | TDE1481 | hypothetical protein | <--> | 1525672 | 1525796 | 125 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
378 | TDE1481 | hypothetical protein | TDE1482 | peptidase, M24 family protein | ->-> | 1526934 | 1527035 | 102 | 23.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
380 | TDE1483 | hypothetical protein | TDE1484 | hypothetical protein | ->-> | 1529128 | 1529294 | 167 | 25.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
381 | TDE1487 | conserved hypothetical protein TIGR01033 | TDE1488 | glyceraldehyde-3-phosphate dehydrogenase, type I | -><- | 1531589 | 1531693 | 105 | 33.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
383 | TDE1495 | hypothetical protein | TDE1496 | chromosome partition protein SmC, putative | <--> | 1540307 | 1540424 | 118 | 28.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
385 | TDE1507 | L-serine dehydratase, iron-sulfur-dependent, beta subunit | TDE1508 | hypothetical protein | <--> | 1555815 | 1556115 | 301 | 25.2% | 0 | 0 | 0 | +: 1/2/2 | -: 1/3/2 | 1 | 0 | 0 | 0 | Result | |
387 | TDE1518 | permease, putative | TDE1519 | hypothetical protein | ->-> | 1565636 | 1565740 | 105 | 26.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
388 | TDE1530 | hypothetical protein | TDE1531 | hypothetical protein | <--> | 1575963 | 1576090 | 128 | 23.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
389 | TDE1547 | ribonuclease HII | TDE1548 | conserved hypothetical protein TIGR00103 | ->-> | 1591861 | 1591974 | 114 | 17.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
390 | TDE1551 | lipoyltransferase and lipoate-protein ligase family protein | TDE1552 | hypothetical protein | <--> | 1595624 | 1595898 | 275 | 26.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
391 | TDE1559 | hypothetical protein | TDE1560 | YD repeat protein | ->-> | 1611472 | 1611589 | 118 | 22% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
392 | TDE1562 | hypothetical protein | TDE1563 | hypothetical protein | ->-> | 1615706 | 1615832 | 127 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
393 | TDE1564 | hypothetical protein | TDE1565 | hypothetical protein | ->-> | 1616765 | 1617032 | 268 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
395 | TDE1569 | hypothetical protein | TDE1570 | hypothetical protein | ->-> | 1620036 | 1620201 | 166 | 31.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
396 | TDE1570 | hypothetical protein | TDE1571 | hypothetical protein | ->-> | 1620667 | 1620807 | 141 | 25.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
397 | TDE1576 | tRNA-i(6)A37 modification enzyme MiaB | TDE1577 | lipoprotein, putative | ->-> | 1624274 | 1624648 | 375 | 24.8% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
398 | TDE1584 | lipoprotein, putative | TDE1585 | hypothetical protein | -><- | 1632915 | 1633021 | 107 | 40.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
399 | TDE1586 | hypothetical protein | TDE1587 | aspartyl-tRNA synthetase | <--> | 1634011 | 1634172 | 162 | 21.6% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
400 | TDE1588 | tryptophanyl-tRNA synthetase | TDE1589 | purine-binding chemotaxis protein | ->-> | 1637027 | 1637143 | 117 | 29.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
401 | TDE1594 | pyridine nucleotide-disulphide oxidoreductase family protein | TDE1595 | cobalamin biosynthesis protein CbiD | <-<- | 1644913 | 1645037 | 125 | 23.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
403 | TDE1602 | hypothetical protein | TDE1603 | ABC transporter, ATP-binding protein | <-<- | 1653348 | 1653500 | 153 | 32.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
404 | TDE1606 | transcriptional regulator, TetR family | TDE1607 | MutT/nudix family protein | <-<- | 1656949 | 1657096 | 148 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
405 | TDE1610 | DNA-binding protein | TDE1611 | hypothetical protein | <--> | 1659587 | 1659840 | 254 | 23.2% | 0 | 0 | 0 | +: 1/0/0 | -: 2/1/0 | 1 | 0 | 0 | 0 | Result | |
406 | TDE1611 | hypothetical protein | TDE1612 | phosphoribosyl transferase domain protein | ->-> | 1660495 | 1660688 | 194 | 41.8% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
407 | TDE1617 | hypothetical protein | TDE1618 | hypothetical protein | <--> | 1664950 | 1665439 | 490 | 27.8% | 0 | 0 | 0 | +: 3/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
408 | TDE1619 | hypothetical protein | TDE1620 | hypothetical protein | -><- | 1666659 | 1667048 | 390 | 43.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
409 | TDE1628 | hypothetical protein | TDE1629 | dihydrolipoamide dehydrogenase | <-<- | 1676947 | 1677242 | 296 | 28.7% | 0 | 0 | 0 | +: 1/3/0 | -: 3/3/5 | 1 | 0 | 0 | 0 | Result | |
410 | TDE1629 | dihydrolipoamide dehydrogenase | TDE1630 | hypothetical protein | <-<- | 1678605 | 1678731 | 127 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
412 | TDE1635 | hypothetical protein | TDE1636 | surface antigen, putative | <-<- | 1683410 | 1683606 | 197 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
413 | TDE1636 | surface antigen, putative | TDE1637 | DNA polymerase I | <--> | 1686046 | 1686211 | 166 | 28.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
414 | TDE1641 | ribose 5-phosphate isomerase A | TDE1642 | hypothetical protein | -><- | 1692737 | 1692860 | 124 | 25% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
415 | TDE1651 | BioY family protein | TDE1652 | ABC transporter, ATP-binding/permease protein | <-<- | 1698823 | 1698946 | 124 | 35.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
416 | TDE1652 | ABC transporter, ATP-binding/permease protein | TDE1654 | ATP-dependent helicase HrpA, putative | <--> | 1700615 | 1702358 | 1744 | 31.5% | 0 | 70 | 10 | +: 1/5/2 | -: 4/1/1 | 1 | 0 | 0 | 0 | Result | |
417 | TDE1654 | ATP-dependent helicase HrpA, putative | TDE1655 | hypothetical protein | ->-> | 1704972 | 1705097 | 126 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
418 | TDE1660 | leucine Rich Repeat domain protein | TDE1661 | hypothetical protein | <--> | 1715357 | 1715541 | 185 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
419 | TDE1665 | hypothetical protein | TDE1666 | hypothetical protein | <--> | 1719220 | 1719385 | 166 | 26.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
420 | TDE1667 | translation initiation factor IF-2B subunit alpha | TDE1668 | amino acid permease family protein | <--> | 1721142 | 1721357 | 216 | 19.4% | 0 | 0 | 0 | +: 1/0/0 | -: 3/0/0 | 1 | 0 | 0 | 0 | Result | |
422 | TDE1675 | ribosomal protein L9 | TDE1676 | ribosomal protein S18 | <-<- | 1729333 | 1729462 | 130 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
423 | TDE1678 | ribosomal protein S6 | TDE1679 | ATP synthase subunit K | <-<- | 1730574 | 1730716 | 143 | 44.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
426 | TDE1690 | hypothetical protein | TDE1691 | hypothetical protein | <-<- | 1747291 | 1747496 | 206 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
427 | TDE1694 | hypothetical protein | TDE1695 | CoA-substrate-specific enzyme activase domain protein | <-<- | 1749457 | 1749587 | 131 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
428 | TDE1699 | hypothetical protein | TDE1700 | hypothetical protein | <--> | 1758011 | 1758179 | 169 | 22.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
429 | TDE1711 | RelA/SpoT domain protein | TDE1712 | flagellar filament outer layer protein | <-<- | 1766809 | 1766955 | 147 | 36.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
430 | TDE1716 | glyoxalase family protein | TDE1717 | hypothetical protein | <--> | 1771319 | 1771570 | 252 | 25% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
431 | TDE1718 | GMP synthase | TDE1719 | transcriptional regulator, MarR family | ->-> | 1773872 | 1774168 | 297 | 30% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
432 | TDE1722 | hypothetical protein | TDE1723 | hypothetical protein | ->-> | 1776579 | 1776774 | 196 | 25.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
433 | TDE1725 | hypothetical protein | TDE1726 | polyA polymerase family protein | <--> | 1779368 | 1779685 | 318 | 29.9% | 0 | 0 | 0 | +: 2/1/2 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
434 | TDE1731 | hypothetical protein | TDE1732 | hypothetical protein | <--> | 1787026 | 1787169 | 144 | 29.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
442 | TDE1765 | hypothetical protein | TDE1766 | hypothetical protein | <-<- | 1811969 | 1812364 | 396 | 28% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
443 | TDE1766 | hypothetical protein | TDE1767 | hypothetical protein | <-<- | 1812824 | 1813015 | 192 | 36.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
444 | TDE1767 | hypothetical protein | TDE1768 | hypothetical protein | <-<- | 1813658 | 1813758 | 101 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
446 | TDE1772 | hypothetical protein | TDE1773 | hypothetical protein | <-<- | 1815908 | 1816498 | 591 | 32.5% | 0 | 0 | 0 | +: 2/2/4 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
447 | TDE1773 | hypothetical protein | TDE1774 | hypothetical protein | <-<- | 1817192 | 1817589 | 398 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
448 | TDE1774 | hypothetical protein | TDE1775 | hypothetical protein | <-<- | 1817980 | 1818159 | 180 | 25% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
449 | TDE1775 | hypothetical protein | TDE1776 | hypothetical protein | <-<- | 1818268 | 1818503 | 236 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
450 | TDE1776 | hypothetical protein | TDE1777 | hypothetical protein | <-<- | 1819323 | 1820045 | 723 | 31.4% | 0 | 0 | 0 | +: 1/6/4 | -: 0/4/0 | 3 | 0 | 0 | 0 | Result | |
451 | TDE1779 | hypothetical protein | TDE1780 | hypothetical protein | <-<- | 1822087 | 1822272 | 186 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
452 | TDE1780 | hypothetical protein | TDE1781 | hypothetical protein | <-<- | 1822399 | 1822567 | 169 | 20.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
453 | TDE1784 | transcriptional activator, AraC family | TDE1785 | hypothetical protein | <--> | 1824514 | 1825131 | 618 | 27.8% | 0 | 0 | 0 | +: 2/3/4 | -: 1/1/1 | 7 | 0 | 0 | 0 | Result | |
454 | TDE1786 | hypothetical protein | TDE1787 | hypothetical protein | <-<- | 1826239 | 1826467 | 229 | 31.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 5 | 0 | 0 | 0 | Result | |
455 | TDE1788 | hypothetical protein | TDE1789 | hypothetical protein | <-<- | 1827006 | 1827427 | 422 | 25.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/1 | 8 | 0 | 0 | 0 | Result | |
456 | TDE1790 | hypothetical protein | TDE1791 | hypothetical protein | <-<- | 1828098 | 1828397 | 300 | 33% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
457 | TDE1791 | hypothetical protein | TDE1792 | hypothetical protein | <-<- | 1828866 | 1829000 | 135 | 41.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
458 | TDE1792 | hypothetical protein | TDE1793 | hydrolase, carbon-nitrogen family | <-<- | 1829886 | 1830046 | 161 | 32.9% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
459 | TDE1793 | hydrolase, carbon-nitrogen family | TDE1794 | hypothetical protein | <-<- | 1830935 | 1831104 | 170 | 42.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
460 | TDE1794 | hypothetical protein | TDE1795 | funZ protein, putative | <-<- | 1833049 | 1833152 | 104 | 48.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
461 | TDE1796 | hypothetical protein | TDE1797 | hypothetical protein | <-<- | 1835606 | 1835744 | 139 | 39.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
462 | TDE1797 | hypothetical protein | TDE1798 | hypothetical protein | <-<- | 1836363 | 1836550 | 188 | 33.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
464 | TDE1802 | hypothetical protein | TDE1803 | hypothetical protein | <-<- | 1838199 | 1838484 | 286 | 42% | 0 | 0 | 0 | +: 1/1/0 | -: 2/1/1 | 4 | 0 | 0 | 0 | Result | |
465 | TDE1803 | hypothetical protein | TDE1804 | hypothetical protein | <-<- | 1839361 | 1839565 | 205 | 35.6% | 0 | 0 | 0 | +: 1/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
466 | TDE1805 | radical SAM domain protein | TDE1806 | hypothetical protein | <-<- | 1842947 | 1843279 | 333 | 30.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
467 | TDE1807 | hypothetical protein | TDE1808 | hypothetical protein | <-<- | 1843857 | 1844173 | 317 | 28.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
468 | TDE1808 | hypothetical protein | TDE1809 | hypothetical protein | <-<- | 1845140 | 1845304 | 165 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
469 | TDE1809 | hypothetical protein | TDE1810 | hypothetical protein | <-<- | 1845404 | 1846013 | 610 | 26.1% | 0 | 0 | 0 | +: 0/5/0 | -: 0/0/0 | 8 | 0 | 0 | 0 | Result | |
470 | TDE1810 | hypothetical protein | TDE1811 | hypothetical protein | <-<- | 1846509 | 1846862 | 354 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
471 | TDE1813 | hypothetical protein | TDE1814 | hypothetical protein | <-<- | 1848340 | 1848518 | 179 | 34.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
472 | TDE1814 | hypothetical protein | TDE1815 | hypothetical protein | <-<- | 1849404 | 1849547 | 144 | 31.2% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
473 | TDE1815 | hypothetical protein | TDE1816 | hypothetical protein | <-<- | 1850235 | 1850566 | 332 | 26.5% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
474 | TDE1817 | hypothetical protein | TDE1818 | hypothetical protein | <-<- | 1852690 | 1852921 | 232 | 33.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
475 | TDE1818 | hypothetical protein | TDE1819 | hypothetical protein | <-<- | 1853882 | 1854124 | 243 | 39.9% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
476 | TDE1819 | hypothetical protein | TDE1820 | hypothetical protein | <-<- | 1854242 | 1854386 | 145 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
477 | TDE1820 | hypothetical protein | TDE1821 | hypothetical protein | <-<- | 1854783 | 1854904 | 122 | 45.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
478 | TDE1822 | hypothetical protein | TDE1823 | hypothetical protein | <-<- | 1856013 | 1856690 | 678 | 22.3% | 0 | 0 | 0 | +: 1/4/3 | -: 1/2/0 | 3 | 0 | 0 | 0 | Result | |
479 | TDE1825 | hypothetical protein | TDE1826 | hypothetical protein | <-<- | 1858435 | 1858650 | 216 | 31.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
480 | TDE1826 | hypothetical protein | TDE1827 | hydrolase, carbon-nitrogen family | <-<- | 1859872 | 1860032 | 161 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
481 | TDE1827 | hydrolase, carbon-nitrogen family | TDE1828 | hypothetical protein | <-<- | 1860921 | 1861023 | 103 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
482 | TDE1828 | hypothetical protein | TDE1829 | hypothetical protein | <-<- | 1861843 | 1862456 | 614 | 32.6% | 0 | 0 | 0 | +: 0/6/0 | -: 1/2/0 | 2 | 0 | 0 | 0 | Result | |
483 | TDE1830 | hypothetical protein | TDE1831 | hypothetical protein | -><- | 1863846 | 1864504 | 659 | 23.8% | 0 | 0 | 0 | +: 0/6/0 | -: 0/1/0 | 9 | 0 | 0 | 0 | Result | |
484 | TDE1831 | hypothetical protein | TDE1832 | hypothetical protein | <-<- | 1865123 | 1865261 | 139 | 38.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
485 | TDE1832 | hypothetical protein | TDE1833 | hypothetical protein | <-<- | 1866012 | 1866366 | 355 | 29.9% | 0 | 0 | 0 | +: 1/3/1 | -: 0/4/0 | 3 | 0 | 0 | 0 | Result | |
486 | TDE1835 | hypothetical protein | TDE1836 | hypothetical protein | <-<- | 1868408 | 1868603 | 196 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
487 | TDE1838 | hypothetical protein | TDE1839 | hypothetical protein | <-<- | 1870256 | 1870480 | 225 | 35.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 3 | 0 | 0 | 0 | Result | |
488 | TDE1839 | hypothetical protein | TDE1840 | hypothetical protein | <-<- | 1871312 | 1871413 | 102 | 51% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
489 | TDE1842 | hypothetical protein | TDE1843 | hypothetical protein | <-<- | 1872096 | 1872288 | 193 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 7 | 0 | 0 | 0 | Result | |
490 | TDE1843 | hypothetical protein | TDE1844 | DNA integrase | <-<- | 1873096 | 1873286 | 191 | 35.6% | 0 | 0 | 1 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
491 | TDE1844 | DNA integrase | TDE1845 | hypothetical protein | <-<- | 1874295 | 1874890 | 596 | 34.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
492 | TDE1846 | hypothetical protein | TDE1847 | hypothetical protein | <--> | 1875517 | 1875803 | 287 | 44.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
493 | TDE1849 | hypothetical protein | TDE1850 | ABC transporter, permease protein, putative | <-<- | 1878214 | 1878316 | 103 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
494 | TDE1853 | hypothetical protein | TDE1854 | nucleotidyltransferase family protein | <-<- | 1882173 | 1882481 | 309 | 28.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
495 | TDE1854 | nucleotidyltransferase family protein | TDE1855 | hypothetical protein | <--> | 1882806 | 1882985 | 180 | 28.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
496 | TDE1857 | hypothetical protein | TDE1858 | transcriptional regulator, PadR family | <--> | 1884541 | 1884771 | 231 | 19.5% | 0 | 0 | 0 | +: 1/0/0 | -: 4/0/0 | 1 | 0 | 0 | 0 | Result | |
497 | TDE1870 | CAAX amino terminal protease family protein | TDE1871 | hypothetical protein | <-<- | 1893583 | 1893751 | 169 | 21.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
498 | TDE1877 | conserved hypothetical protein TIGR00046 | TDE1878 | hydrolase, haloacid dehalogenase-like family | <-<- | 1898524 | 1900049 | 1526 | 38.5% | 0 | 1 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
499 | TDE1878 | hydrolase, haloacid dehalogenase-like family | TDE1880 | hypothetical protein | <--> | 1900836 | 1902674 | 1839 | 45.8% | 0 | 39 | 0 | +: 1/3/1 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
500 | TDE1889 | branched-chain amino acid transport system II carrier protein | TDE1890 | hypothetical protein | <--> | 1910979 | 1911151 | 173 | 38.2% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
501 | TDE1893 | GTP-binding protein LepA | TDE1894 | ferredoxin | <--> | 1914108 | 1914252 | 145 | 24.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
502 | TDE1904 | hypothetical protein | TDE1905 | hypothetical protein | <-<- | 1923704 | 1923811 | 108 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
503 | TDE1910 | 1-deoxy-D-xylulose-5-phosphate synthase | TDE1911 | hypothetical protein | <-<- | 1928928 | 1929032 | 105 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
504 | TDE1911 | hypothetical protein | TDE1912 | redox-sensing transcriptional repressor Rex | <--> | 1929189 | 1929315 | 127 | 28.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
505 | TDE1915 | alcohol dehydrogenase, iron-containing | TDE1916 | glycerol kinase | <-<- | 1933194 | 1933366 | 173 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 6 | 0 | 0 | 0 | Result | |
506 | TDE1921 | hypothetical protein | TDE1922 | hypothetical protein | <-<- | 1940820 | 1941002 | 183 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
507 | TDE1924 | hypothetical protein | TDE1925 | peptidyl-prolyl cis-trans isomerase, FKBP-type | <--> | 1941977 | 1942119 | 143 | 33.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
510 | TDE1932 | hypothetical protein | TDE1933 | hypothetical protein | <-<- | 1949500 | 1949689 | 190 | 25.8% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
511 | TDE1934 | hypothetical protein | TDE1935 | hypothetical protein | ->-> | 1952865 | 1953133 | 269 | 49.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 3 | 0 | 0 | 0 | Result | |
512 | TDE1937 | hypothetical protein | TDE1938 | hypothetical protein | ->-> | 1953509 | 1953779 | 271 | 37.6% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
513 | TDE1938 | hypothetical protein | TDE1939 | hypothetical protein | ->-> | 1954647 | 1954766 | 120 | 30% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
516 | TDE1949 | ABC transporter, ATP-binding protein | TDE1950 | membrane lipoprotein TmpC, putative | <-<- | 1966158 | 1966280 | 123 | 35% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
517 | TDE1950 | membrane lipoprotein TmpC, putative | TDE1951 | ribonuclease Z | <-<- | 1967355 | 1967492 | 138 | 20.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
518 | TDE1953 | transcriptional regulator, TetR family | TDE1954 | prevent-host-death family protein | <--> | 1969762 | 1969925 | 164 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
519 | TDE1955 | hypothetical protein | TDE1956 | hypothetical protein | <--> | 1970991 | 1971253 | 263 | 31.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
520 | TDE1956 | hypothetical protein | TDE1957 | hypothetical protein | ->-> | 1971443 | 1971588 | 146 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
521 | TDE1957 | hypothetical protein | TDE1958 | surface protein, putative | -><- | 1972294 | 1972398 | 105 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
522 | TDE1958 | surface protein, putative | TDE1959 | hypothetical protein | <-<- | 1973776 | 1973894 | 119 | 26.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
523 | TDE1959 | hypothetical protein | TDE1960 | hypothetical protein | <--> | 1974288 | 1974437 | 150 | 31.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
524 | TDE1962 | hypothetical protein | TDE1963 | selenocysteine-specific translation elongation factor | <--> | 1975295 | 1975428 | 134 | 39.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
525 | TDE1964 | Na/Pi cotransporter family protein | TDE1965 | sodium/hydrogen exchanger family protein | <-<- | 1978871 | 1978984 | 114 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
526 | TDE1965 | sodium/hydrogen exchanger family protein | TDE1966 | trypsin domain/PDZ domain protein | <--> | 1980242 | 1980412 | 171 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
527 | TDE1975 | hypothetical protein | TDE1976 | hypothetical protein | ->-> | 1989117 | 1989254 | 138 | 22.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
528 | TDE1977 | hypothetical protein | TDE1978 | hypothetical protein | -><- | 1991409 | 1991590 | 182 | 41.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
529 | TDE1981 | hypothetical protein | TDE1982 | hypothetical protein | -><- | 1992498 | 1992600 | 103 | 46.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
530 | TDE1982 | hypothetical protein | TDE1983 | hypothetical protein | <-<- | 1993075 | 1993465 | 391 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
532 | TDE1990 | ATP-dependent helicase, DinG family | TDE1991 | hypothetical protein | <-<- | 2008587 | 2008723 | 137 | 28.5% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
533 | TDE1991 | hypothetical protein | TDE1992 | OmpA family protein | <--> | 2009489 | 2009603 | 115 | 22.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
534 | TDE1997 | hypothetical protein | TDE1998 | phosphohexose mutase family protein | ->-> | 2015317 | 2015439 | 123 | 32.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
535 | TDE1999 | DNA polymerase III domain protein | TDE2000 | ABC transporter, ATP-binding/permease protein, HlyB family | ->-> | 2017857 | 2017998 | 142 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
536 | TDE2000 | ABC transporter, ATP-binding/permease protein, HlyB family | TDE2001 | oligoendopeptidase F, putative | -><- | 2019700 | 2019864 | 165 | 27.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
537 | TDE2002 | hypothetical protein | TDE2003 | internalin-related protein | <--> | 2022286 | 2022416 | 131 | 29.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
538 | TDE2009 | hypothetical protein | TDE2010 | hypothetical protein | ->-> | 2031308 | 2031457 | 150 | 42% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
539 | TDE2011 | hypothetical protein | TDE2012 | hypothetical protein | -><- | 2033543 | 2033889 | 347 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
540 | TDE2013 | hypothetical protein | TDE2014 | ankyrin repeat protein | <-<- | 2034797 | 2035524 | 728 | 36.5% | 0 | 0 | 7 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
541 | TDE2015 | lipoprotein, putative | TDE2016 | hypothetical protein | <-<- | 2037623 | 2037913 | 291 | 20.3% | 0 | 0 | 0 | +: 0/1/0 | -: 2/2/0 | 1 | 0 | 0 | 0 | Result | |
542 | TDE2016 | hypothetical protein | TDE2017 | hypothetical protein | <-<- | 2038985 | 2039112 | 128 | 26.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
543 | TDE2017 | hypothetical protein | TDE2018 | lipoprotein, putative | <-<- | 2039488 | 2039677 | 190 | 17.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
544 | TDE2022 | YD repeat protein | TDE2023 | TPR domain protein | <-<- | 2049313 | 2049594 | 282 | 23.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
545 | TDE2026 | hypothetical protein | TDE2027 | hypothetical protein | <--> | 2052593 | 2052788 | 196 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
546 | TDE2028 | OmpA family protein | TDE2029 | hydrolase, TatD family | -><- | 2057080 | 2057237 | 158 | 40.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
550 | TDE2045 | hypothetical protein | TDE2047 | hypothetical protein | <-<- | 2075024 | 2076147 | 1124 | 42.3% | 0 | 3 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
551 | TDE2047 | hypothetical protein | TDE2048 | hypothetical protein | <--> | 2076442 | 2076550 | 109 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
552 | TDE2051 | hypothetical protein | TDE2052 | aminotransferase, class V | <--> | 2080389 | 2080541 | 153 | 32% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
553 | TDE2058 | hypothetical protein | TDE2059 | hypothetical protein | <-<- | 2086263 | 2086398 | 136 | 27.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
554 | TDE2065 | FeoA family protein | TDE2066 | exodeoxyribonuclease VII, small subunit | <--> | 2091870 | 2092045 | 176 | 29% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
556 | TDE2068 | antigen, putative | TDE2069 | endoribonuclease L-PSP, putative | ->-> | 2096656 | 2096771 | 116 | 37.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
557 | TDE2070 | hypothetical protein | TDE2071 | hypothetical protein | ->-> | 2098273 | 2098380 | 108 | 25% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
558 | TDE2071 | hypothetical protein | TDE2072 | hypothetical protein | ->-> | 2098654 | 2098952 | 299 | 26.4% | 0 | 0 | 0 | +: 1/1/1 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
559 | TDE2083 | anti-anti-sigma factor | TDE2084 | RNA methyltransferase, TrmH family | <--> | 2113254 | 2113533 | 280 | 22.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
561 | TDE2090 | NAD(P)H-dependent glycerol-3-phosphate dehydrogenase | TDE2091 | amino acid ABC transporter, amino acid-binding protein, putative | <--> | 2118727 | 2118852 | 126 | 25.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
562 | TDE2094 | hypothetical protein | TDE2095 | hypothetical protein | <--> | 2121410 | 2121888 | 479 | 33.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
563 | TDE2097 | hypothetical protein | TDE2098 | hypothetical protein | <-<- | 2124832 | 2125040 | 209 | 34.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
565 | TDE2102 | hypothetical protein | TDE2103 | glycosyl transferase, group 2 family protein | <-<- | 2127438 | 2127616 | 179 | 38% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
566 | TDE2103 | glycosyl transferase, group 2 family protein | TDE2104 | hypothetical protein | <-<- | 2128484 | 2128614 | 131 | 61.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
567 | TDE2104 | hypothetical protein | TDE2105 | hypothetical protein | <-<- | 2131174 | 2131295 | 122 | 27% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
568 | TDE2116 | hypothetical protein | TDE2117 | hypothetical protein | <--> | 2147799 | 2147945 | 147 | 21.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
569 | TDE2118 | DNA topoisomerase IV subunit A | TDE2119 | glycine reductase complex selenoprotein GrdB2 | <-<- | 2151356 | 2151487 | 132 | 37.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
570 | TDE2120 | glycine reductase complex proprotein GrdE2 | TDE2121 | hypothetical protein | <-<- | 2154085 | 2154201 | 117 | 20.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
571 | TDE2122 | DHH superfamily protein | TDE2123 | hypothetical protein | <--> | 2156001 | 2156163 | 163 | 21.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
572 | TDE2133 | cobalt transport protein, putative | TDE2134 | hypothetical protein | <--> | 2164414 | 2164586 | 173 | 42.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
573 | TDE2136 | hypothetical protein | TDE2137 | hypothetical protein | <--> | 2165750 | 2166264 | 515 | 35.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
574 | TDE2139 | hypothetical protein | TDE2140 | protease II | -><- | 2172958 | 2173172 | 215 | 44.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 3 | 0 | 0 | 0 | Result | |
575 | TDE2140 | protease II | TDE2141 | hypothetical protein | <-<- | 2175231 | 2175672 | 442 | 35.5% | 0 | 0 | 0 | +: 1/1/1 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
576 | TDE2142 | methyl-accepting chemotaxis protein | TDE2143 | penicillin-binding protein | ->-> | 2178048 | 2178246 | 199 | 39.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
578 | TDE2156 | translation initiation factor IF-3 | TDE2157 | ABC transporter, permease protein, putative | <--> | 2190810 | 2191078 | 269 | 34.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
579 | TDE2160 | hypothetical protein | TDE2161 | acetyltransferase, GNAT family | <--> | 2194059 | 2194229 | 171 | 29.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
580 | TDE2169 | hypothetical protein | TDE2170 | hypothetical protein | -><- | 2201570 | 2201695 | 126 | 40.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
581 | TDE2171 | hypothetical protein | TDE2172 | hypothetical protein | <-<- | 2202632 | 2202741 | 110 | 28.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
582 | TDE2173 | hypothetical protein | TDE2174 | hypothetical protein | <-<- | 2203079 | 2203188 | 110 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
583 | TDE2174 | hypothetical protein | TDE2175 | hypothetical protein | <-<- | 2204125 | 2204227 | 103 | 27.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
584 | TDE2177 | hypothetical protein | TDE2178 | hypothetical protein | <-<- | 2206615 | 2206772 | 158 | 40.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
585 | TDE2178 | hypothetical protein | TDE2179 | voltage-gated chloride channel | <--> | 2208849 | 2209087 | 239 | 31% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
586 | TDE2182 | hypothetical protein | TDE2183 | hypothetical protein | <--> | 2215126 | 2215338 | 213 | 30% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
587 | TDE2191 | pyrimidine-nucleoside phosphorylase | TDE2192 | threonine synthase | <--> | 2227742 | 2227900 | 159 | 27.7% | 0 | 0 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
588 | TDE2194 | 8-amino-7-oxononanoate synthase, putative | TDE2195 | RNA pseudouridylate synthase family protein | <--> | 2231123 | 2231260 | 138 | 29.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
589 | TDE2202 | membrane protein | TDE2204 | Na+/H+ antiporter family protein | ->-> | 2239665 | 2241308 | 1644 | 38.1% | 0 | 0 | 249 | +: 2/2/2 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
590 | TDE2205 | enoate reductase, putative | TDE2206 | hypothetical protein | <-<- | 2244846 | 2245010 | 165 | 41.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
591 | TDE2207 | hypothetical protein | TDE2208 | conserved hypothetical protein TIGR00486 | <--> | 2246725 | 2246872 | 148 | 27.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
592 | TDE2209 | CarB family protein | TDE2210 | hypothetical protein | -><- | 2249361 | 2249483 | 123 | 45.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
593 | TDE2211 | hypothetical protein | TDE2212 | galactokinase | <-<- | 2251407 | 2251571 | 165 | 32.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
594 | TDE2212 | galactokinase | TDE2213 | hypothetical protein | <--> | 2252772 | 2252939 | 168 | 29.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
595 | TDE2216 | galactoside ABC transporter, ATP-binding protein | TDE2217 | galactose/glucose-binding lipoprotein | <-<- | 2256744 | 2256853 | 110 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
596 | TDE2219 | hypothetical protein | TDE2220 | prolyl-tRNA synthetase | <--> | 2260737 | 2261024 | 288 | 30.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
597 | TDE2227 | hypothetical protein | TDE2228 | aminoacyl-histidine dipeptidase, putative | -><- | 2267195 | 2267376 | 182 | 35.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
598 | TDE2230 | hypothetical protein | TDE2231 | internalin-related protein | ->-> | 2269514 | 2269777 | 264 | 26.5% | 0 | 0 | 0 | +: 1/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
599 | TDE2234 | iron compound ABC transporter, periplasmic iron compound-binding protein, putative | TDE2235 | methylaspartate ammonia-lyase | <-<- | 2273336 | 2273439 | 104 | 31.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
600 | TDE2236 | methylaspartate mutase, E subunit | TDE2237 | hypothetical protein | <-<- | 2276208 | 2276387 | 180 | 24.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
601 | TDE2242 | antigen, putative | TDE2243 | CutC family protein | <-<- | 2282125 | 2282303 | 179 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
602 | TDE2243 | CutC family protein | TDE2244 | hypothetical protein | <--> | 2283045 | 2283159 | 115 | 29.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
603 | TDE2250 | hypothetical protein | TDE2251 | uracil permease | ->-> | 2289470 | 2289579 | 110 | 41.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
604 | TDE2256 | hypothetical protein | TDE2257 | 5'-nucleotidase family protein | <-<- | 2293478 | 2293592 | 115 | 40% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
605 | TDE2257 | 5'-nucleotidase family protein | TDE2258 | surface antigen BspA, putative | <-<- | 2295195 | 2295423 | 229 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
606 | TDE2258 | surface antigen BspA, putative | TDE2259 | hypothetical protein | <-<- | 2296492 | 2296616 | 125 | 44% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
607 | TDE2259 | hypothetical protein | TDE2260 | hypothetical protein | <--> | 2297328 | 2297477 | 150 | 57.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
608 | TDE2260 | hypothetical protein | TDE2261 | hypothetical protein | -><- | 2297634 | 2298004 | 371 | 36.9% | 0 | 0 | 4 | +: 0/1/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
609 | TDE2264 | ABC transporter, ATP-binding/permease protein | TDE2265 | hypothetical protein | <--> | 2302124 | 2302304 | 181 | 35.4% | 0 | 0 | 0 | +: 0/1/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
610 | TDE2265 | hypothetical protein | TDE2266 | reverse transcriptase family protein | -><- | 2302695 | 2303131 | 437 | 36.8% | 0 | 0 | 0 | +: 0/4/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
611 | TDE2267 | HRDC domain protein | TDE2268 | hypothetical protein | <-<- | 2304555 | 2304911 | 357 | 43.7% | 0 | 0 | 6 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
612 | TDE2269 | hypothetical protein | TDE2270 | methyl-accepting chemotaxis protein | <-<- | 2306011 | 2306369 | 359 | 28.7% | 0 | 0 | 0 | +: 0/3/0 | -: 1/3/2 | 1 | 0 | 0 | 0 | Result | |
614 | TDE2273 | hypothetical protein | TDE2274 | hypothetical protein | ->-> | 2310213 | 2310340 | 128 | 25.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
615 | TDE2281 | LysM domain protein | TDE2282 | tRNA synthetase, class II family protein | <-<- | 2318584 | 2318717 | 134 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
616 | TDE2287 | peptidyl-prolyl cis-trans isomerase, FKBP-type | TDE2288 | hypothetical protein | <-<- | 2325149 | 2325251 | 103 | 28.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
617 | TDE2288 | hypothetical protein | TDE2289 | phosphoribulokinase/uridine kinase family protein | <--> | 2325735 | 2325903 | 169 | 26% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
618 | TDE2300 | trypsin domain/PDZ domain protein | TDE2301 | FlhB domain protein | <--> | 2341525 | 2341648 | 124 | 20.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
619 | TDE2307 | seryl-tRNA synthetase | TDE2308 | hypothetical protein | <--> | 2345594 | 2345743 | 150 | 25.3% | 0 | 0 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
620 | TDE2312 | hypothetical protein | TDE2313 | hypothetical protein | -><- | 2349110 | 2349595 | 486 | 39.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
621 | TDE2317 | hemolysin III | TDE2318 | LysM domain/M23/M37 peptidase domain protein | <--> | 2354862 | 2355004 | 143 | 27.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
622 | TDE2323 | mechanosensitive ion channel family protein | TDE2324 | DNA-binding response regulator | <--> | 2359175 | 2359327 | 153 | 31.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
623 | TDE2324 | DNA-binding response regulator | TDE2325 | hypothetical protein | ->-> | 2359982 | 2360091 | 110 | 28.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
624 | TDE2327 | ATP-dependent Clp protease, ATP-binding subunit ClpB | TDE2328 | efflux pump component MtrF | <--> | 2364718 | 2364873 | 156 | 25.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
625 | TDE2330 | hypothetical protein | TDE2332 | hypothetical protein | -><- | 2366759 | 2367627 | 869 | 32.1% | 0 | 0 | 2 | +: 1/1/0 | -: 1/0/0 | 1 | 1 | 1 | 165 | Result | aacggagaaatttctttacaaaaacagttggagtatgtaacataataaaatactccttagctatttatatttcaatcctgaattagttaaagccccttggaaaatagaaatactttgcccagagaattccaagagttctacaaggtaatccagaggagttattta |
626 | TDE2333 | sanA protein, putative | TDE2334 | hypothetical protein | <--> | 2368642 | 2368768 | 127 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
627 | TDE2334 | hypothetical protein | TDE2335 | ATP-dependent DNA helicase, UvrD/Rep family | ->-> | 2369648 | 2369780 | 133 | 35.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
628 | TDE2336 | sodium/dicarboxylate symporter family protein | TDE2337 | aminopeptidase | <--> | 2373287 | 2373434 | 148 | 29.1% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
629 | TDE2338 | hypothetical protein | TDE2339 | leucyl-tRNA synthetase | <--> | 2374810 | 2374984 | 175 | 36.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
630 | TDE2347 | 30S ribosomal protein S2 | TDE2348 | maf protein | <-<- | 2384469 | 2384697 | 229 | 39.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
631 | TDE2349 | hypothetical protein | TDE2350 | lipoprotein, putative | <-<- | 2386031 | 2386142 | 112 | 29.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
632 | TDE2350 | lipoprotein, putative | TDE2351 | hypothetical protein | <--> | 2386752 | 2386872 | 121 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
633 | TDE2366 | high-affinity branched-chain amino acid ABC transporter, permease protein | TDE2367 | transcriptional regulator, putative | <--> | 2400949 | 2401219 | 271 | 19.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
635 | TDE2377 | hypothetical protein | TDE2378 | ABC transporter, ATP-binding protein, putative | <--> | 2407758 | 2407858 | 101 | 26.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
636 | TDE2391 | peptidyl-prolyl cis-trans isomerase | TDE2392 | hypothetical protein | <-<- | 2421641 | 2421762 | 122 | 30.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
637 | TDE2394 | hypothetical protein | TDE2395 | Jag protein, putative | <-<- | 2422703 | 2422833 | 131 | 48.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
639 | TDE2400 | 50S ribosomal protein L34 | TDE2401 | hypothetical protein | <--> | 2426418 | 2426645 | 228 | 27.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
640 | TDE2406 | TldD/PmbA family protein | TDE2407 | amidophosphoribosyltransferase | <-<- | 2433604 | 2433733 | 130 | 25.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
641 | TDE2407 | amidophosphoribosyltransferase | TDE2408 | hypothetical protein | <-<- | 2435198 | 2435306 | 109 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
642 | TDE2411 | glycogen phosphorylase | TDE2412 | acetyltransferase, GNAT family | <-<- | 2439778 | 2439884 | 107 | 29.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
643 | TDE2418 | hypothetical protein | TDE2419 | hypothetical protein | <-<- | 2443924 | 2444112 | 189 | 36.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/5/0 | 1 | 0 | 0 | 0 | Result | |
644 | TDE2419 | hypothetical protein | TDE2420 | DNA-directed RNA polymerase beta' subunit | <-<- | 2444860 | 2445049 | 190 | 42.6% | 0 | 0 | 0 | +: 0/1/0 | -: 1/3/3 | 1 | 0 | 0 | 0 | Result | |
645 | TDE2421 | DNA-directed RNA polymerase beta subunit | TDE2422 | ribosomal protein L7/L12 | <-<- | 2452853 | 2453000 | 148 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
646 | TDE2422 | ribosomal protein L7/L12 | TDE2423 | ribosomal protein L10 | <-<- | 2453391 | 2453506 | 116 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
648 | TDE2434 | polysaccharide deacetylase family protein | TDE2435 | hypothetical protein | <-<- | 2465748 | 2465955 | 208 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
649 | TDE2435 | hypothetical protein | TDE2436 | hypothetical protein | <--> | 2466553 | 2466741 | 189 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
650 | TDE2440 | ABC transporter, ATP-binding/permease protein, putative | TDE2441 | hypothetical protein | <-<- | 2472134 | 2472445 | 312 | 27.2% | 0 | 0 | 0 | +: 0/1/0 | -: 1/4/4 | 1 | 0 | 0 | 0 | Result | |
651 | TDE2443 | hypothetical protein | TDE2444 | hypothetical protein | <-<- | 2473550 | 2473828 | 279 | 22.9% | 0 | 0 | 0 | +: 1/3/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
652 | TDE2444 | hypothetical protein | TDE2445 | DNA-binding protein | <--> | 2474303 | 2474421 | 119 | 20.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
653 | TDE2445 | DNA-binding protein | TDE2446 | malate dehydrogenase | -><- | 2474728 | 2474863 | 136 | 31.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
654 | TDE2451 | S-adenosylmethionine:tRNA ribosyltransferase-isomerase | TDE2452 | hypothetical protein | ->-> | 2481016 | 2481149 | 134 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
655 | TDE2452 | hypothetical protein | TDE2453 | hypothetical protein | ->-> | 2481447 | 2481576 | 130 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
656 | TDE2453 | hypothetical protein | TDE2454 | hypothetical protein | -><- | 2482162 | 2482440 | 279 | 29.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
657 | TDE2454 | hypothetical protein | TDE2456 | hypothetical protein | <-<- | 2483467 | 2484225 | 759 | 33.7% | 0 | 0 | 33 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
658 | TDE2456 | hypothetical protein | TDE2457 | hypothetical protein | <-<- | 2484664 | 2484787 | 124 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
659 | TDE2462 | hypothetical protein | TDE2463 | hypothetical protein | <--> | 2488515 | 2488629 | 115 | 23.5% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
661 | TDE2476 | carbamate kinase | TDE2477 | selenocysteine synthase | <--> | 2499541 | 2499662 | 122 | 32.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
662 | TDE2481 | hypothetical protein | TDE2482 | hypothetical protein | <--> | 2505568 | 2505675 | 108 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
664 | TDE2485 | hypothetical protein | TDE2486 | hypothetical protein | <--> | 2509214 | 2509376 | 163 | 24.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
665 | TDE2489 | peptide chain release factor 1 | TDE2490 | primosomal protein N' | <-<- | 2512567 | 2512792 | 226 | 38.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
666 | TDE2492 | hypothetical protein | TDE2493 | hypothetical protein | <-<- | 2516505 | 2516834 | 330 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 1/6/5 | 1 | 0 | 0 | 0 | Result | |
670 | TDE2498 | metallo-beta-lactamase family protein | TDE2499 | hypothetical protein | <-<- | 2523052 | 2523280 | 229 | 35.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/2 | 2 | 0 | 0 | 0 | Result | |
672 | TDE2504 | O-sialoglycoprotein endopeptidase | TDE2505 | hypothetical protein | ->-> | 2530158 | 2530264 | 107 | 23.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
673 | TDE2508 | hypothetical protein | TDE2509 | transcriptional regulator, AraC family | ->-> | 2533182 | 2533327 | 146 | 24.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
674 | TDE2509 | transcriptional regulator, AraC family | TDE2510 | ABC transporter, ATP-binding/permease protein | ->-> | 2534213 | 2534321 | 109 | 20.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
675 | TDE2514 | serine/threonine protein phosphatase family protein | TDE2515 | hypothetical protein | <-<- | 2540623 | 2541061 | 439 | 41% | 0 | 0 | 1 | +: 0/4/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
676 | TDE2516 | hypothetical protein | TDE2517 | DNA repair protein RadA | -><- | 2542254 | 2542543 | 290 | 45.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 2 | 0 | 0 | 0 | Result | |
677 | TDE2518 | nucleotide-binding protein | TDE2519 | hypothetical protein | <-<- | 2544796 | 2544928 | 133 | 24.1% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
678 | TDE2520 | hypothetical protein | TDE2521 | hypothetical protein | <-<- | 2547889 | 2548044 | 156 | 25% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
681 | TDE2529 | hypothetical protein | TDE2530 | radical SAM domain protein | <--> | 2557329 | 2557501 | 173 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 2/1/0 | 1 | 0 | 0 | 0 | Result | |
682 | TDE2534 | endonuclease III | TDE2535 | pyruvate kinase | ->-> | 2560917 | 2561031 | 115 | 32.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
683 | TDE2540 | lipoprotein, putative | TDE2541 | hypothetical protein | <--> | 2568072 | 2568304 | 233 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
684 | TDE2541 | hypothetical protein | TDE2542 | antigen, putative | -><- | 2569250 | 2569530 | 281 | 43.1% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
685 | TDE2544 | hypothetical protein | TDE2545 | hypothetical protein | <-<- | 2571127 | 2571259 | 133 | 33.1% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
686 | TDE2546 | hypothetical protein | TDE2547 | hypothetical protein | <--> | 2572852 | 2573016 | 165 | 31.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
687 | TDE2548 | hypothetical protein | TDE2549 | methyl-accepting chemotaxis protein | <--> | 2573289 | 2573424 | 136 | 33.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
688 | TDE2552 | ABC transporter, ATP-binding/permease protein | TDE2553 | lysyl-tRNA synthetase | <-<- | 2579035 | 2579136 | 102 | 38.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
689 | TDE2553 | lysyl-tRNA synthetase | TDE2554 | chaperonin, 33 kDa family | <--> | 2580724 | 2580884 | 161 | 31.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
690 | TDE2557 | hypothetical protein | TDE2558 | ABC transporter, ATP-binding/permease protein | <-<- | 2583474 | 2583818 | 345 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
693 | TDE2572 | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase | TDE2573 | glucose-6-phosphate isomerase | <--> | 2598829 | 2598941 | 113 | 30.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
694 | TDE2578 | hypothetical protein | TDE2579 | ATP-dependent DNA helicase RecG | <-<- | 2603245 | 2603377 | 133 | 29.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
695 | TDE2579 | ATP-dependent DNA helicase RecG | TDE2580 | GGDEF domain protein | <--> | 2605415 | 2605585 | 171 | 27.5% | 0 | 0 | 0 | +: 3/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
696 | TDE2581 | hypothetical protein | TDE2582 | GGDEF domain protein | ->-> | 2611693 | 2611928 | 236 | 23.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
697 | TDE2586 | DNA polymerase III subunits gamma and tau | TDE2587 | endonuclease/exonuclease/phosphatase family protein | <--> | 2622180 | 2622330 | 151 | 23.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
699 | TDE2588 | integrase domain protein | TDE2589 | putative aminopeptidase 1 | -><- | 2624839 | 2625089 | 251 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
701 | TDE2606 | urocanate hydratase | TDE2607 | hypothetical protein | ->-> | 2648612 | 2648725 | 114 | 43.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
702 | TDE2613 | hypothetical protein | TDE2614 | ApbE family protein | -><- | 2655917 | 2656107 | 191 | 26.2% | 0 | 0 | 0 | +: 1/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
703 | TDE2626 | ABC transporter, ATP-binding/permease protein | TDE2627 | transcriptional regulator, TetR family | <-<- | 2668493 | 2668621 | 129 | 32.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
705 | TDE2637 | hypothetical protein | TDE2638 | hypothetical protein | <--> | 2677407 | 2677632 | 226 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
706 | TDE2650 | transcriptional regulator, putative | TDE2651 | ABC transporter, ATP-binding protein | <--> | 2689122 | 2689288 | 167 | 23.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
708 | TDE2671 | hypothetical protein | TDE2672 | TPR domain protein | <--> | 2710183 | 2710349 | 167 | 26.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
709 | TDE2674 | hypothetical protein | TDE2675 | hypothetical protein | <--> | 2713368 | 2713513 | 146 | 24% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
710 | TDE2678 | alpha-amylase family protein | TDE2679 | hypothetical protein | <--> | 2719481 | 2719657 | 177 | 35% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
711 | TDE2691 | hypothetical protein | TDE2692 | CTP synthetase | ->-> | 2729407 | 2729560 | 154 | 38.3% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
713 | TDE2696 | TPR domain protein | TDE2697 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein | <--> | 2740127 | 2740399 | 273 | 35.5% | 0 | 0 | 0 | +: 3/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
715 | TDE2706 | hypothetical protein | TDE2707 | hypothetical protein | <--> | 2753884 | 2754086 | 203 | 21.7% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
716 | TDE2707 | hypothetical protein | TDE2708 | hypothetical protein | -><- | 2754990 | 2755225 | 236 | 40.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
717 | TDE2708 | hypothetical protein | TDE2709 | BNR domain protein | <-<- | 2761589 | 2761783 | 195 | 34.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
718 | TDE2709 | BNR domain protein | TDE2710 | MATE efflux family protein | <--> | 2766449 | 2766669 | 221 | 21.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
719 | TDE2710 | MATE efflux family protein | TDE2711 | hypothetical protein | ->-> | 2768035 | 2768151 | 117 | 18.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
720 | TDE2713 | RNA methyltransferase, TrmH family | TDE2714 | hypothetical protein | <-<- | 2770415 | 2770716 | 302 | 47.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
721 | TDE2715 | hypothetical protein | TDE2716 | HAD-superfamily hydrolase, subfamily IA | ->-> | 2772997 | 2773334 | 338 | 35.8% | 0 | 1 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
722 | TDE2718 | magnesium transporter | TDE2719 | hypothetical protein | <--> | 2776001 | 2776184 | 184 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
723 | TDE2727 | GTPase YjeQ, putative | TDE2728 | hypothetical protein | <--> | 2785436 | 2785746 | 311 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 2/1/0 | 1 | 0 | 0 | 0 | Result | |
724 | TDE2729 | hypothetical protein | TDE2730 | hydrolase, TatD family | <--> | 2786548 | 2786725 | 178 | 24.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
725 | TDE2734 | hypothetical protein | TDE2735 | surface antigen, putative | ->-> | 2789922 | 2790293 | 372 | 49.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
726 | TDE2735 | surface antigen, putative | TDE2736 | hypothetical protein | -><- | 2791677 | 2791791 | 115 | 54.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
728 | TDE2737 | hypothetical protein | TDE2738 | oligoendopeptidase F, putative | ->-> | 2792751 | 2792902 | 152 | 43.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
729 | TDE2738 | oligoendopeptidase F, putative | TDE2739 | hypothetical protein | ->-> | 2794634 | 2794812 | 179 | 37.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
730 | TDE2739 | hypothetical protein | TDE2740 | type I restriction-modification system, S subunit, truncation | ->-> | 2795230 | 2795341 | 112 | 37.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
731 | TDE2740 | type I restriction-modification system, S subunit, truncation | TDE2741 | hypothetical protein | ->-> | 2795831 | 2796002 | 172 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
732 | TDE2741 | hypothetical protein | TDE2742 | site-specific recombinase, phage integrase family | -><- | 2796783 | 2796939 | 157 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
733 | TDE2747 | type I restriction-modification system, R subunit | TDE2748 | acetyltransferase, GNAT family | <--> | 2805033 | 2805247 | 215 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
735 | TDE2752 | hypothetical protein | TDE2753 | LysM domain/M23/M37 peptidase domain protein | -><- | 2809531 | 2809647 | 117 | 40.2% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
736 | TDE2753 | LysM domain/M23/M37 peptidase domain protein | TDE2754 | ornithine cyclodeaminase | <-<- | 2810740 | 2810850 | 111 | 26.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
737 | TDE2756 | bacterial extracellular solute-binding protein, family 5 | TDE2757 | nucleotidyltransferase family protein | <--> | 2813608 | 2813812 | 205 | 29.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
738 | TDE2770 | flagellar hook-length control protein FliK | TDE2771 | hypothetical protein | <--> | 2824508 | 2824858 | 351 | 28.8% | 0 | 0 | 1 | +: 0/3/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
739 | TDE2775 | lipoprotein, putative | TDE2776 | proline iminopeptidase | ->-> | 2827191 | 2827503 | 313 | 31.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
740 | TDE2782 | ABC transporter, ATP-binding/permease protein | TDE2783 | methyl-accepting chemotaxis protein | <--> | 2834367 | 2834549 | 183 | 20.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
Total: | 0 | 10 | 0/45 | 642 | 1 |