refSNP ID: rs11540441 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 120/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: Not available Clinical Association: unknown HGVS Names NM_001004.3:c.-35A>G NT_035113.6:g.750006A>G Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss16228226 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs11540441 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss16228226 CGAP-GAI|1464510 fwd/B C/T gcggcgtctgcggcggaggcggcggagaag ctcacgcgtgcgacctcggtggcgacaggg 11/18/03 11/22/03 120 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs11540441|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='C/T'|mol=cDNA|build=120 AGGCGACGTA GCGCATCGCG GCGGCGTCTG CGGCGGAGGC GGCGGAGAAG Y CTCACGCGTG CGACCTCGGT GGCGACAGGG AGGAAAAAAA AAAAAAAGTT   GeneView GeneView via analysis of contig annotation: RPLP2 ribosomal protein, large, P2 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_035113->NM_001004 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_035113->NM_001004-> 750006 forward 71 5' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs11540441 maps exactly once on NCBI human chromosome 11 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 11 NW_001838016.1 451688 625834 minus A alt_assembly_8 HuRef HuRef view 50 11 NT_035113.6 750006 800006 minus A ref_assembly reference reference view 50 11 NW_924962.1 456312 876556 minus A alt_assembly_1 Celera Celera view 50   NCBI Resource Links Submitter-Referenced GenBank AI306406 BM875341 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank mRNA: NM_001004.3 BC005354.1 BC005920.1 UniGene Cluster ID 437594   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .