PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:79175 Links RH36467 Homo sapiens chromosome 6, locus TMEM217 Macaca mulatta chromosome 4, locus LOC719382 Pan troglodytes chromosome 6, locus TMEM217 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTCTTCTAACAGGAAATCTGGC Reverse primer: AAAGGCTTTAAAAAGTCCCAGC PCR product size: 120 (bp), Homo sapiens    Homo sapiens Name: RH36467 Also known as: stSG15109 Polymorphism info:   Cross References Gene GeneID: 221468   Symbol: TMEM217   Description: transmembrane protein 217   Position: 6p21.2 Mapping Information RH36467 Sequence Map: Chr 6|HuRef Map Viewer   Position: 36926728-36926847 (bp)   RH36467 Sequence Map: Chr 6 Map Viewer   Position: 37315732-37315851 (bp)   RH36467 Sequence Map: Chr 6|Celera Map Viewer   Position: 38762795-38762914 (bp)   stSG15109 NCBI RH Map: Chr 6 Map Viewer   Position: 556.7 (cR)   Lod score: 1.91   stSG15109 GeneMap99-GB4 Map: Chr 6 Map Viewer   Position: 133.95 (cR3000)   Lod score: 0.01   Reference Interval: D6S1558-D6S1616 Electronic PCR results Genomic (5 of 7)[Show All Hits] AL353579.17 96455 .. 96574 (120 bp)   CH003453.1 37604391 .. 37604510 (120 bp)   CH003501.1 39110979 .. 39111098 (120 bp)   CH471081.1 10227116 .. 10227235 (120 bp)   CM000257.1 38762795 .. 38762914 (120 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC022752.2 97394 .. 97513 (120 bp)     ESTs (1) R06076.1 18 .. 137 (120 bp)     Whole Genome Shotgun sequences (4) AADD01068915.1 8294 .. 8413 (120 bp)   AADC01059391.1 79437 .. 79556 (120 bp)   AADB02010024.1 762113 .. 762232 (120 bp)   ABBA01038280.1 8210 .. 8329 (120 bp)        Macaca mulatta Name: RH36467 Polymorphism info:   Cross References Gene GeneID: 719382   Symbol: LOC719382   Description: hypothetical protein LOC719382   Position:   Mapping Information RH36467 Sequence Map: Chr 4 Map Viewer   Position: 37011668-37011787 (bp)    Pan troglodytes Name: RH36467 Polymorphism info:   Cross References Gene GeneID: 747587   Symbol: TMEM217   Description: transmembrane protein 217   Position:   Mapping Information RH36467 Sequence Map: Chr 6 Map Viewer   Position: 38066257-38066376 (bp) Electronic PCR results Genomic (1) CM000320.1 38066257 .. 38066376 (120 bp)     Whole Genome Shotgun sequences (2) AADA01002071.1 10900 .. 11019 (120 bp)   AACZ02070887.1 6237 .. 6356 (120 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement