PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:75779 Links D10S1555 Homo sapiens chromosome 10 Macaca mulatta chromosome 9 Pan troglodytes chromosome 10 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TGTTCCCGATCAAACAGAGT Reverse primer: TTTCTGTGTCAATTCTCAGCC PCR product size: 155-156 (bp), Homo sapiens GenBank Accession: G05038    Homo sapiens Name: D10S1555 Also known as: D10S2274 G00-372-483 GDB:372483 GDB:628173 RH127 SHGC-6637 SHGC-74616 WI-640 stSG359 Polymorphism info:   Cross References Mapping Information D10S1555 Sequence Map: Chr 10|HuRef Map Viewer   Position: 34030884-34031039 (bp)   D10S1555 Sequence Map: Chr 10|Celera Map Viewer   Position: 34076942-34077097 (bp)   D10S1555 Sequence Map: Chr 10 Map Viewer   Position: 34351559-34351714 (bp)   SHGC-6637 NCBI RH Map: Chr 10 Map Viewer   Position: 522.7 (cR)   Lod score: 5.00   SHGC-6637 TNG Map: Chr 10 Map Viewer   Position: 18531 (cR50000)   Lod score: 16.1   Reference Interval: 43   WI-640 Whitehead-RH Map: Chr 10 Map Viewer   Position: 231.9 (cR3000)   Lod score: F   SHGC-6637 Stanford-G3 Map: Chr 10 Map Viewer   Position: 1930 (cR10000)   Lod score: F   Reference Interval: 27   WI-640 Whitehead-YAC Map: Chr 10 Map Viewer   Reference Interval: WC10.1 Electronic PCR results Genomic (5 of 10)[Show All Hits] G05038.1 78 .. 233 (156 bp)   AL117338.15 167447 .. 167602 (156 bp)   AL160409.12 669 .. 824 (156 bp)   CH003457.1 34376721 .. 34376876 (156 bp)   CH003505.1 35887493 .. 35887648 (156 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC040971.3 105175 .. 105330 (156 bp)   AL391004.9 160636 .. 160791 (156 bp)   AL591464.2 33194 .. 33349 (156 bp)     Whole Genome Shotgun sequences (4) AADD01106471.1 35235 .. 35390 (156 bp)   AADC01089632.1 203437 .. 203592 (156 bp)   AADB02013028.1 3144643 .. 3144798 (156 bp)   ABBA01033363.1 91402 .. 91557 (156 bp)        Macaca mulatta Name: D10S1555 Polymorphism info:   Mapping Information D10S1555 Sequence Map: Chr 9 Map Viewer   Position: 34213586-34213739 (bp)    Pan troglodytes Name: D10S1555 Polymorphism info:   Mapping Information D10S1555 Sequence Map: Chr 10 Map Viewer   Position: 34774452-34774607 (bp) Electronic PCR results Genomic (1) CM000324.1 34774452 .. 34774607 (156 bp)     Whole Genome Shotgun sequences (2) AADA01235224.1 3862 .. 4017 (156 bp)   AACZ02113014.1 22121 .. 22276 (156 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement