refSNP ID: rs2304197 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 100/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: T Clinical Association: unknown HGVS Names NM_006012.2:c.556-43C>T NT_011255.14:g.6306226C>T Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss3251021 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs2304197 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss3251021 YUSUKE|IMS-JST061106 fwd/B C/T acctccagcctccctgtgaggggctgacgc gataccaacctttaccccctcactcccttg 09/05/01 10/10/03 100 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs2304197|allelePos=61|totalLen=121|taxid=9606|snpclass=1|alleles='C/T'|mol=Genomic|build=100 GCCCAAAGCC CAGGGAAGCT CCTGAGTGCC ACCTCCAGCC TCCCTGTGAG GGGCTGACGC Y GATACCAACC TTTACCCCCT CACTCCCTTG GACGTCCCTC AGGGCCAAGC CACAGACATT   GeneView GeneView via analysis of contig annotation: CLPP ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_011255->NM_006012 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_011255->NM_006012->NP_006003 6306226 forward intron GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs2304197 maps exactly once on NCBI human chromosome 19 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 19 NW_001838477.2 97730 6126512 minus G alt_assembly_8 HuRef HuRef view 60 19 NW_927173.1 5563737 6305013 plus C alt_assembly_1 Celera Celera view 60 19 NT_011255.14 6306226 6317226 plus C ref_assembly reference reference view 60   NCBI Resource Links Submitter-Referenced GenBank AC011491.4 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): NM_006012.2 3D structure mapping NP_006003     Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .