PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:66688 Links D19S928 Homo sapiens chromosome 19, locus LOC619404, polymorphic Pan troglodytes chromosome 19, locus ZNF536 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TCCCTTAGACAAGTTATCTGTGG Reverse primer: GAGTCTGATTATGTTCAGTCTTTGC PCR product size: 170-174 (bp), Homo sapiens GenBank Accession: Z54029    Homo sapiens Name: D19S928 Also known as: AFMC021WD1 AFMc021wd1 C021WD1 GDB:612432 HSC021WD1 SHGC-21088 W7034 Polymorphism info: on genetic map Cross References Gene GeneID: 619404   Symbol: LOC619404   Description: cataract, congenital nuclear, autosomal recessive   Position: 19q13 Mapping Information D19S928 Sequence Map: Chr 19|HuRef Map Viewer   Position: 27654847-27655018 (bp)   D19S928 Sequence Map: Chr 19|Celera Map Viewer   Position: 27844566-27844735 (bp)   D19S928 Sequence Map: Chr 19 Map Viewer   Position: 35842653-35842824 (bp)   D19S928 deCODE Map: Chr 19 Map Viewer   Position: 52.32 (cM)   AFMc021wd1 Genethon Map: Chr 19 Map Viewer   Position: 51.70 (cM)   AFMc021wd1 Marshfield Map: Chr 19 Map Viewer   Position: 52.59 (cM)   AFMc021wd1 NCBI RH Map: Chr 19 Map Viewer   Position: 293.3 (cR)   Lod score: 2.26   SHGC-21088 Stanford-G3 Map: Chr 19 Map Viewer   Position: 1199 (cR10000)   Lod score: F   Reference Interval: 17   AFMc021wd1 GeneMap99-G3 Map: Chr 19 Map Viewer   Position: 1210 (cR10000)   Lod score: F   Reference Interval: D19S919-D19S414   D19S928 Whitehead-YAC Map: Chr 19 Map Viewer   Reference Interval: WC19.2 Electronic PCR results Genomic (5 of 8)[Show All Hits] Z54029.1 91 .. 264 (174 bp)   AC011478.3 23907 .. 24078 (172 bp)   CH003466.1 28051848 .. 28052019 (172 bp)   CH003514.1 31036366 .. 31036537 (172 bp)   CH471129.2 3416134 .. 3416303 (170 bp)     Whole Genome Shotgun sequences (4) AADD01164661.1 5523 .. 5694 (172 bp)   AADC01138757.1 44935 .. 45106 (172 bp)   AADB02020135.1 1473545 .. 1473714 (170 bp)   ABBA01039573.1 44909 .. 45080 (172 bp)        Pan troglodytes Name: D19S928 Polymorphism info:   Cross References Gene GeneID: 455915   Symbol: ZNF536   Description: zinc finger protein 536   Position:   Mapping Information D19S928 Sequence Map: Chr 19 Map Viewer   Position: 36018928-36019091 (bp) Electronic PCR results Genomic (1) CM000333.1 36018928 .. 36019091 (164 bp)     Whole Genome Shotgun sequences (2) AADA01238319.1 17416 .. 17579 (164 bp)   AACZ02184266.1 6574 .. 6737 (164 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement