refSNP ID: rs12547 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 52/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: T Clinical Association: unknown HGVS Names NM_020679.2:c.*198A>G NT_010641.15:g.7188895T>C Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss16253483 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs12547 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss14827 CGAP-GAI|59440 fwd/B C/T agttgcccttctctgcctggccgtggtggg tgtggtggggaaaggggctcagggcaggac 08/23/99 10/10/03 52 cDNA 99 % ss16253483 CGAP-GAI|1506571 rev/T A/G gtcctgccctgagcccctttccccaccaca cccaccacggccaggcagagaagggcaact 11/18/03 11/22/03 120 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs12547|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='C/T'|mol=cDNA|build=120 ACAGTGCAGT GGCTCTTGGG AGTTGCCCTT CTCTGCCTGG CCGTGGTGGG Y TGTGGTGGGG AAAGGGGCTC AGGGCAGGAC CACGGCATAA GTGGGAAACA   GeneView GeneView via analysis of contig annotation: MIF4GD MIF4G domain containing View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_010641->NM_020679 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_010641->NM_020679-> 7188895 reverse 1098 3' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs12547 maps exactly once on NCBI human chromosome 17 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 17 NW_001838454.2 2234405 68672817 minus A alt_assembly_8 HuRef HuRef view 50 17 NW_926918.1 10360372 69854971 plus T alt_assembly_1 Celera Celera view 50 17 NT_010641.15 7188895 70774218 plus T ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank AI187353 AA592948 AA993214 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank mRNA: NM_020679.2 AF225422.1 BC033759.1 EU287989.1 UniGene Cluster ID 325631   Population Diversity Sample Ascertainment Genotypes Alleles ss# Population Individual Group Chrom. Sample Cnt. Source HWP C T ss16253483 CEPH 184 AF 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0 0 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .