PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:66011 Links STS-T97010 Homo sapiens chromosome 15, locus SPG11 Macaca mulatta chromosome 7, locus LOC712221 Pan troglodytes chromosome 15, locus SPG11 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TCCAGAAACTTTGAGAGAACC Reverse primer: AGATACTGTGGCTGAACTCG PCR product size: 185 (bp), Homo sapiens    Homo sapiens Name: STS-T97010 Also known as: sts-T97010 Polymorphism info:   Cross References Gene GeneID: 80208   Symbol: SPG11   Description: spastic paraplegia 11 (autosomal recessive)   Position: 15q14 UniGene Hs.656271 Spastic paraplegia 11 (autosomal recessive)   Hs.700877 Transcribed locus, moderately similar to NP_079413.3 hypothetical protein LO... Mapping Information STS-T97010 Sequence Map: Chr 15|HuRef Map Viewer   Position: 21689287-21689472 (bp)   STS-T97010 Sequence Map: Chr 15|Celera Map Viewer   Position: 21755380-21755565 (bp)   STS-T97010 Sequence Map: Chr 15 Map Viewer   Position: 42652919-42653104 (bp)   sts-T97010 NCBI RH Map: Chr 15 Map Viewer   Position: 169.1 (cR)   Lod score: 1.06   sts-T97010 GeneMap99-GB4 Map: Chr 15 Map Viewer   Position: 160.64 (cR3000)   Lod score: 0.14   Reference Interval: D15S146-D15S117 Electronic PCR results mRNA (1) AK091176.1 2528 .. 2713 (186 bp)     Genomic (5 of 7)[Show All Hits] G25473.1 16 .. 200 (185 bp)   AC009996.7 59255 .. 59440 (186 bp)   CH003462.1 21208182 .. 21208367 (186 bp)   CH471082.1 853197 .. 853382 (186 bp)   CM000266.1 21755380 .. 21755565 (186 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC009821.3 57509 .. 57694 (186 bp)     ESTs (5 of 8)[Show All Hits] T97010.1 16 .. 200 (185 bp)   W88766.1 42 .. 227 (186 bp)   AA004933.1 42 .. 227 (186 bp)   AA701859.1 42 .. 227 (186 bp)   AI762069.1 73 .. 258 (186 bp)     Whole Genome Shotgun sequences (3) AADD01142844.1 6274 .. 6459 (186 bp)   AADB02016428.1 853197 .. 853382 (186 bp)   ABBA01039203.1 2290 .. 2475 (186 bp)        Macaca mulatta Name: STS-T97010 Polymorphism info:   Cross References Gene GeneID: 712221   Symbol: LOC712221   Description: hypothetical protein LOC712221   Position:   Mapping Information STS-T97010 Sequence Map: Chr 7 Map Viewer   Position: 22987518-22987703 (bp)    Pan troglodytes Name: STS-T97010 Polymorphism info:   Cross References Gene GeneID: 453711   Symbol: SPG11   Description: spastic paraplegia 11 (autosomal recessive)   Position:   Mapping Information STS-T97010 Sequence Map: Chr 15 Map Viewer   Position: 41717234-41717419 (bp) Electronic PCR results Genomic (1) CM000329.1 41717234 .. 41717419 (186 bp)     Whole Genome Shotgun sequences (2) AADA01219587.1 14332 .. 14517 (186 bp)   AACZ02154617.1 14863 .. 15048 (186 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement