PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:36905 Links RH66382 Homo sapiens chromosome 6, locus FAM135A Macaca mulatta chromosome 4, locus LOC714862 Pan troglodytes chromosome 6, locus LOC472050 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CTCCAGATAGCCATTTGTTCA Reverse primer: TTGGGTAGAAGTTCTGTTTGC PCR product size: 140 (bp), Homo sapiens    Homo sapiens Name: RH66382 Also known as: stSG35546 Polymorphism info:   Cross References Gene GeneID: 57579   Symbol: FAM135A   Description: family with sequence similarity 135, member A   Position: 6q12-q13 UniGene Hs.211700 Family with sequence similarity 135, member A Mapping Information RH66382 Sequence Map: Chr 6|HuRef Map Viewer   Position: 68468884-68469023 (bp)   RH66382 Sequence Map: Chr 6 Map Viewer   Position: 71327447-71327586 (bp)   RH66382 Sequence Map: Chr 6|Celera Map Viewer   Position: 71659142-71659281 (bp)   stSG35546 NCBI RH Map: Chr 6 Map Viewer   Position: 808.9 (cR)   Lod score: 2.47   stSG35546 GeneMap99-GB4 Map: Chr 6 Map Viewer   Position: 309.12 (cR3000)   Lod score: 3.00   Reference Interval: D6S430-D6S1596 Electronic PCR results RefSeq mRNA (2) NM_001105531.1 5580 .. 5719 (140 bp)   NM_020819.3 5443 .. 5582 (140 bp)     mRNA (5) AB037832.1 5751 .. 5890 (140 bp)   AJ420590.1 1917 .. 2056 (140 bp)   AK128547.1 3145 .. 3284 (140 bp)   BC065767.1 1477 .. 1616 (140 bp)   BC030797.1 5080 .. 5219 (140 bp)     Genomic (5 of 7)[Show All Hits] AL078591.18 143829 .. 143968 (140 bp)   CH003453.1 67785259 .. 67785447 (189 bp)   CH003501.1 70733508 .. 70733647 (140 bp)   CH471051.2 3727746 .. 3727885 (140 bp)   CM000257.1 71659142 .. 71659281 (140 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC073199.3 122564 .. 122703 (140 bp)     ESTs (5 of 14)[Show All Hits] T16333.1 9 .. 148 (140 bp)   R55763.1 20 .. 159 (140 bp)   AA732888.1 9 .. 148 (140 bp)   AA765928.1 39 .. 178 (140 bp)   AI308839.1 2 .. 141 (140 bp)     Whole Genome Shotgun sequences (3) AADC01060918.1 146196 .. 146335 (140 bp)   AADB02010107.1 983510 .. 983649 (140 bp)   ABBA01040269.1 26133 .. 26272 (140 bp)        Macaca mulatta Name: RH66382 Polymorphism info:   Cross References Gene GeneID: 714862   Symbol: LOC714862   Description: similar to CG32333-PA, isoform A   Position:   UniGene Mmu.6270 Similar to CG32333-PA, isoform A Mapping Information RH66382 Sequence Map: Chr 4 Map Viewer   Position: 66903937-66904078 (bp)    Pan troglodytes Name: RH66382 Polymorphism info:   Cross References Gene GeneID: 472050   Symbol: LOC472050   Description: similar to KIAA1411 protein   Position:   Mapping Information RH66382 Sequence Map: Chr 6 Map Viewer   Position: 71317580-71317719 (bp) Electronic PCR results RefSeq mRNA (5 of 11)[Show All Hits] XM_001138203.1 6141 .. 6280 (140 bp)   XM_001138286.1 6169 .. 6308 (140 bp)   XM_001138358.1 6169 .. 6308 (140 bp)   XM_001137773.1 5282 .. 5421 (140 bp)   XM_001137858.1 5651 .. 5790 (140 bp)     Genomic (1) CM000320.1 71317580 .. 71317719 (140 bp)     Whole Genome Shotgun sequences (2) AADA01069907.1 2683 .. 2822 (140 bp)   AACZ02072648.1 2479 .. 2618 (140 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement