- Genome Home
- Assembly
- Overlap View
Alignment last updated: 11/11/2008 11:57:19
AP000872.5 Homo sapiens genomic DNA, chromosome 11q clone:RP11-727A20, complete sequences [htgs_phase3]
Length: 157,330 bp
AP001533.4 Homo sapiens genomic DNA, chromosome 11q clone:RP11-788M5, complete sequence [htgs_phase3]
Length: 207,183 bp
Join evaluation: Alignment count: 1
|
Mismatches = 0, Gaps = 0, Length = 15169 Percent identity = 100% Score = 3.007e+04 bits (15169), Expect = 0 10 BAC and 100 Fosmid bridging clones. 10 BAC and 100 Fosmid concordant clones. 0 BAC and 0 Fosmid discordant clones. AP000872.5 >142162 gaattctgctcatatgtgtaatattcttcatctctaacaagtccatgatttaattgagta 142221 AP001533.4 >1 ............................................................ 60 AP000872.5 >142222 tgagctctgtttttcagttttttacttagataatcctacaagttcctgaatggcacataa 142281 AP001533.4 >61 ............................................................ 120 AP000872.5 >142282 taggagctcaatatatattggttactctttagggaacactgagggacatttctttctgtc 142341 AP001533.4 >121 ............................................................ 180 AP000872.5 >142342 gttatttccggtccttgtttgctcagaagaaatattttctattccattctctctaatcat 142401 AP001533.4 >181 ............................................................ 240 AP000872.5 >142402 ttaaagccaatttaggtcatcattctttaaaatatgtttctattttgatgattggatttt 142461 AP001533.4 >241 ............................................................ 300 AP000872.5 >142462 taaaaaataatggtcacttttagaagacaaagttgtttaattctgtttccaatcctacta 142521 AP001533.4 >301 ............................................................ 360 AP000872.5 >142522 actatgttttggagcatttcgaagcagaatgtatcttatagaaatcatttgtctattcat 142581 AP001533.4 >361 ............................................................ 420 AP000872.5 >142582 tttatattatatttctattcattctatattttttgtactaagtttttttcaaaaatagtg 142641 AP001533.4 >421 ............................................................ 480 AP000872.5 >142642 aatgacaaaaatgaatgacagacatagatgagatataatgttaggaaattgataaatctt 142701 AP001533.4 >481 ............................................................ 540 AP000872.5 >142702 tattaaactttattctgacttttgtatttattttatatcacctctaactccagataataa 142761 AP001533.4 >541 ............................................................ 600 AP000872.5 >142762 gaaagtaaaaggttacacaatatttactagtgaataggtcaagcaccatgatcagtggag 142821 AP001533.4 >601 ............................................................ 660 AP000872.5 >142822 cagaaatgacaacttctatcatttcttttgactgagaaaaaaggatggtcagaaatttat 142881 AP001533.4 >661 ............................................................ 720 AP000872.5 >142882 tgtgctctgaaataactcgatttatctgcagaattatgagaaatgcatttcaatttttcc 142941 AP001533.4 >721 ............................................................ 780 AP000872.5 >142942 ataaatatatattttaagggataaaatatgaataataaattctaattacattatagttat 143001 AP001533.4 >781 ............................................................ 840 AP000872.5 >143002 ggtgtaataatactgtgatgctgactgaaatgggagattaaattcacttttaactttatg 143061 AP001533.4 >841 ............................................................ 900 AP000872.5 >143062 aagaccaaattatggggaagccacaagtgggtgttagctgaaaacccacttatgttggga 143121 AP001533.4 >901 ............................................................ 960 AP000872.5 >143122 gctctacagatcaataacattctgaggtcaatcttgtgaaatgataggaaatatacatat 143181 AP001533.4 >961 ............................................................ 1020 AP000872.5 >143182 tggtctctgccttcagttcctaagtctaaaactcctaaactcctaaaactcttgggattt 143241 AP001533.4 >1021 ............................................................ 1080 AP000872.5 >143242 cctaatagaggttctaggagcatcttttgttctaatatttggtgtttggcctggttcttg 143301 AP001533.4 >1081 ............................................................ 1140 AP000872.5 >143302 gcacagagctccaaaatccctcagaatttcctgggtaataagatcattttttgttctaat 143361 AP001533.4 >1141 ............................................................ 1200 AP000872.5 >143362 gaggtgactcttggtggacccccagatgtgggctggttaccagaatgaccaaactgtgat 143421 AP001533.4 >1201 ............................................................ 1260 AP000872.5 >143422 tagaaacttggaactttgagtctcagatttcattctctggaaaggggagaggagctggag 143481 AP001533.4 >1261 ............................................................ 1320 AP000872.5 >143482 ttaataattggattacgtttatgtgatgaagcctccttaaaaaaaaatccctaatgtatg 143541 AP001533.4 >1321 ............................................................ 1380 AP000872.5 >143542 gggttcacaaagcttctggactgttgagcacatccctagctgggagggtggtgcacccca 143601 AP001533.4 >1381 ............................................................ 1440 AP000872.5 >143602 actccacagggcagaagctcgtgaacttctacccttctggacctcaccctatgtacctct 143661 AP001533.4 >1441 ............................................................ 1500 AP000872.5 >143662 tcatctgtatcctttatcatatctttaccttaaactagtaaacatgagtgttactccgaa 143721 AP001533.4 >1501 ............................................................ 1560 AP000872.5 >143722 ttctgtgagctgttctacaaaggaatgaacctgggtggggttgtgggaacctttgatttg 143781 AP001533.4 >1561 ............................................................ 1620 AP000872.5 >143782 tagccaagtcagatagaaattgtggaaaagctgggaacccaccccctttcgattggcatc 143841 AP001533.4 >1621 ............................................................ 1680 AP000872.5 >143842 tggagtgggagcagtcttatgggacagggcccttaacaagtgaggtctgtgctaactcca 143901 AP001533.4 >1681 ............................................................ 1740 AP000872.5 >143902 gacagtactggaattgattgcatcgtaggacacccagttgtctgcagagaattggagaat 143961 AP001533.4 >1741 ............................................................ 1800 AP000872.5 >143962 tgtgggaaaaaactccatgaatctggtgtcagatgtgaagtattgacaatggcgtaagtt 144021 AP001533.4 >1801 ............................................................ 1860 AP000872.5 >144022 cagaaagaaaaactgatttttccccttaatctacgaaccagcaccttgctccaactctca 144081 AP001533.4 >1861 ............................................................ 1920 AP000872.5 >144082 cactcacatcctaaagtatggggctcagggagcttctagattgttgaacacaaccacatg 144141 AP001533.4 >1921 ............................................................ 1980 AP000872.5 >144142 ctgggagtgtggtgcaccctaactccacagggcagaggctcctgtgcttggacccatctg 144201 AP001533.4 >1981 ............................................................ 2040 AP000872.5 >144202 gacctcactgtgagcttggatgagtcacagattctcttgagtctcaagttctctatttgt 144261 AP001533.4 >2041 ............................................................ 2100 AP000872.5 >144262 aaaatgaagtgatggaattgatttctttcataacatgtgtttcattgctgacccctctga 144321 AP001533.4 >2101 ............................................................ 2160 AP000872.5 >144322 gaagctgatgagagcaatggaaagcatgtgtacatacacagacactaaaattctgcatag 144381 AP001533.4 >2161 ............................................................ 2220 AP000872.5 >144382 actgggttgggattcaaactgcctcaaaaccagttgttgccccacggataaagaacccat 144441 AP001533.4 >2221 ............................................................ 2280 AP000872.5 >144442 ggaccagatgatttttagaggcttgtgcaactctaacatcctatgactctttgaccatat 144501 AP001533.4 >2281 ............................................................ 2340 AP000872.5 >144502 ttttgttttaattaagcttaaacggtatattgagaatccaaaaaaaaaaaaacacaaaca 144561 AP001533.4 >2341 ............................................................ 2400 AP000872.5 >144562 aacaaacaaacaaaaaaaacccaggcaaaggaagaaacatatttataagcaataagatat 144621 AP001533.4 >2401 ............................................................ 2460 AP000872.5 >144622 tttaagtgcaacacatatctgggtataagagttaccaatttagatactagaatgtggtat 144681 AP001533.4 >2461 ............................................................ 2520 AP000872.5 >144682 ttggataggtaaaaataatgaatttgatatgtggaaataaatatatcagagctagcaatg 144741 AP001533.4 >2521 ............................................................ 2580 AP000872.5 >144742 cattttaacattaatgttttaaataataagattgctgtttattacaagatgaattaattt 144801 AP001533.4 >2581 ............................................................ 2640 AP000872.5 >144802 atacatcctttagcagtacatgttcttcacatgtcattcaaaagttccatacagaaaaat 144861 AP001533.4 >2641 ............................................................ 2700 AP000872.5 >144862 atttaaaaacagatcaaaacatagtgactttcaaattaatatagaggaccttattgattt 144921 AP001533.4 >2701 ............................................................ 2760 AP000872.5 >144922 gaaatacatattttgaagatgatttttaaacaactaatttttatatttatcatgcacttt 144981 AP001533.4 >2761 ............................................................ 2820 AP000872.5 >144982 gttaaacttgacatgttaaaatcattaaaatgattttactattctgctttaaccaataaa 145041 AP001533.4 >2821 ............................................................ 2880 AP000872.5 >145042 acaaacttaaatatttctgtttgacttagtttatccttagggtgtggtgtgaagcttatt 145101 AP001533.4 >2881 ............................................................ 2940 AP000872.5 >145102 attgttattactatgatgatgatgatgaggcaggaccttgctctgtcaccggcattgaag 145161 AP001533.4 >2941 ............................................................ 3000 AP000872.5 >145162 tgcaattgtgcgaccatggctcgctgcagccttgacctcccgggatcaagtaatcctccc 145221 AP001533.4 >3001 ............................................................ 3060 AP000872.5 >145222 acctcatcctcctgaaaatctgggactaccacacctgaataatttcatattttttttata 145281 AP001533.4 >3061 ............................................................ 3120 AP000872.5 >145282 gagatgagatctccatatattgcccagactggtgtccaacttctggactcaaatggtcca 145341 AP001533.4 >3121 ............................................................ 3180 AP000872.5 >145342 ccctcctcagctttccaaagtgcttggattacagataagagccactgtgactggcctatt 145401 AP001533.4 >3181 ............................................................ 3240 AP000872.5 >145402 tgcttattattttaagtcatttaaaaaatgagcttttctgaaaatagctgagaaaaagca 145461 AP001533.4 >3241 ............................................................ 3300 AP000872.5 >145462 aattaacattttgaacagtaatgtcaaattaaattttagaaaaatatagtggaaaacatg 145521 AP001533.4 >3301 ............................................................ 3360 AP000872.5 >145522 acttgtttttcagaaccaagattttattaaagggaatggatagagaggaaatagacaaaa 145581 AP001533.4 >3361 ............................................................ 3420 AP000872.5 >145582 ggaaaattgtttttgcagataaaacaaaaattactttttaaaatgtagttaaaatttagt 145641 AP001533.4 >3421 ............................................................ 3480 AP000872.5 >145642 gataatagaatatagaaaaaatgaaaagttttagttcagggaaaactgcataaggtttga 145701 AP001533.4 >3481 ............................................................ 3540 AP000872.5 >145702 aagtattacaaatcaaactagtgctatatactatggctatccaatttcataattaaatgg 145761 AP001533.4 >3541 ............................................................ 3600 AP000872.5 >145762 acaaaactagaataaaattatttgggggaattttttaagtaccataaatttcttcagatt 145821 AP001533.4 >3601 ............................................................ 3660 AP000872.5 >145822 attgatagatgtgtagaaaataaaaaggaactatttgtttcttgcattttccagtaatta 145881 AP001533.4 >3661 ............................................................ 3720 AP000872.5 >145882 aatggaaacattcaggttcaaattgcataaagttaaacaaatacaataactactaagaat 145941 AP001533.4 >3721 ............................................................ 3780 AP000872.5 >145942 ttataaaacgaaattaaataaaaatctgttaaaccgttacccagatttcagtataagaat 146001 AP001533.4 >3781 ............................................................ 3840 AP000872.5 >146002 aaggcatagttaaataatcgaaaatgaagtaaataatactataatttccaaaaatgttga 146061 AP001533.4 >3841 ............................................................ 3900 AP000872.5 >146062 attttgagattacatgtatgtcatacacccccattttttcagataggtaaaatgaagttc 146121 AP001533.4 >3901 ............................................................ 3960 AP000872.5 >146122 agaacggttataggtaactcatgccaactcaataggaagtgtcagaacacagcttagaac 146181 AP001533.4 >3961 ............................................................ 4020 AP000872.5 >146182 acaaattttttcatttcaagcttccaaactcttttccctatattttagccttcatggtag 146241 AP001533.4 >4021 ............................................................ 4080 AP000872.5 >146242 gtaatgttttctgtcttttgtaaaagggacctgactgtatctttctctaggttgctttca 146301 AP001533.4 >4081 ............................................................ 4140 AP000872.5 >146302 ctcatgcatatacacatgcagagttaagaagagccatttattatccctgaataatttcac 146361 AP001533.4 >4141 ............................................................ 4200 AP000872.5 >146362 tgtaagtcctacttaagtagaaataacttaggataacaacttgttaaataaattagctcc 146421 AP001533.4 >4201 ............................................................ 4260 AP000872.5 >146422 acatgatatatgtaatttagtattatgaagaaagtttttaaaaatataaaaatgatgtga 146481 AP001533.4 >4261 ............................................................ 4320 AP000872.5 >146482 agtgtgaatagccttggaatataagttcagcattttttgatttcttgaatgaaacacact 146541 AP001533.4 >4321 ............................................................ 4380 AP000872.5 >146542 ttgtagttacacagcaaaagtgaattcagcccagtttagatagccaattcagataacttg 146601 AP001533.4 >4381 ............................................................ 4440 AP000872.5 >146602 ggaacaaacaataatcccttcctgtccctggatcacctctacttaagtcagtttcctcat 146661 AP001533.4 >4441 ............................................................ 4500 AP000872.5 >146662 gacatatgcttatttattgttcagaaaacattctattaactgagctaccagtaaagatga 146721 AP001533.4 >4501 ............................................................ 4560 AP000872.5 >146722 ttttcttaaattttgcatgacctttgaatataaaatatttttctcttcacaaaattagtt 146781 AP001533.4 >4561 ............................................................ 4620 AP000872.5 >146782 taaaactgaagacctcttacataatagttatgaatatcattctctatttgaaggttggaa 146841 AP001533.4 >4621 ............................................................ 4680 AP000872.5 >146842 attataaaaattcagggtatgtgcaaacaatcattttttgacatgttttctaagaagcag 146901 AP001533.4 >4681 ............................................................ 4740 AP000872.5 >146902 ctcctcatctatctcccattgtggggcatgggtctacattgacagccacctcttcagcta 146961 AP001533.4 >4741 ............................................................ 4800 AP000872.5 >146962 cacaggttgaaggtccatgtgggcctgaaatgccattctccagaggcactcccacacaaa 147021 AP001533.4 >4801 ............................................................ 4860 AP000872.5 >147022 gcgccttctcccatgtgccatgacttctttaccagatcagcattctaatttttttgaata 147081 AP001533.4 >4861 ............................................................ 4920 AP000872.5 >147082 taggtttgttgggcttttcaactaataagtatctatattggtaagcttagtatattttgg 147141 AP001533.4 >4921 ............................................................ 4980 AP000872.5 >147142 ttatgaaaaatcatatatttggtgacccaagatttattcatttataaactcataaatttc 147201 AP001533.4 >4981 ............................................................ 5040 AP000872.5 >147202 atctacctatgttgtagaatgttgtgttgtatctgttaagggtgtttagcaatgtattta 147261 AP001533.4 >5041 ............................................................ 5100 AP000872.5 >147262 cctatttcttagtaaaagtcatatttgtataaggttttcttgtctgtgaaggaattttat 147321 AP001533.4 >5101 ............................................................ 5160 AP000872.5 >147322 aggcactattgcatttaaatgcaaagctctttattaaaatatttatctctgcttgttaga 147381 AP001533.4 >5161 ............................................................ 5220 AP000872.5 >147382 taatgatgcagaggctcagaattaaagatagattactaaaatcacagtggattacttttc 147441 AP001533.4 >5221 ............................................................ 5280 AP000872.5 >147442 aaaacagtgacaaacctatcttttaaaactctgggtgaagttctgcagtttgttttactg 147501 AP001533.4 >5281 ............................................................ 5340 AP000872.5 >147502 taggtatttatttgcatgctgttaacaagtatctgaaattggcacataggccatctctgt 147561 AP001533.4 >5341 ............................................................ 5400 AP000872.5 >147562 ttaggttcacaggtatctgtgttcttgttcactgattacctccatttttaccagtatact 147621 AP001533.4 >5401 ............................................................ 5460 AP000872.5 >147622 ataacctgttatcaaccaggtttttattgttttctattttttttttagaaattcttagtg 147681 AP001533.4 >5461 ............................................................ 5520 AP000872.5 >147682 ataattatcctttcttaaatcaacaaaacaaacacttgtaccagaacttgaaaatttgtc 147741 AP001533.4 >5521 ............................................................ 5580 AP000872.5 >147742 aaagctaaatgtatatattatttggttaaatgaatataaatattgcatagcagtttcccc 147801 AP001533.4 >5581 ............................................................ 5640 AP000872.5 >147802 cctcaatttcaattttgttgcgtaatttatggatttttaccttagttattttatattttc 147861 AP001533.4 >5641 ............................................................ 5700 AP000872.5 >147862 tcaagtttagtgaggagttagttgatatgtttcttactatccatactttttaataacatc 147921 AP001533.4 >5701 ............................................................ 5760 AP000872.5 >147922 atttaagaacttgaatagattcataataatggtttgtgaatcttaaaacttttcaaaaaa 147981 AP001533.4 >5761 ............................................................ 5820 AP000872.5 >147982 ctatttcttgacattgatccatcttaaaattattctttcctttgattaatttttcattac 148041 AP001533.4 >5821 ............................................................ 5880 AP000872.5 >148042 ttagtaatgtttcaataagaacactgcatcttacaaacattgtgatcattaggaaatgtg 148101 AP001533.4 >5881 ............................................................ 5940 AP000872.5 >148102 tatagatttataaaaatcaaaataaatatgacaagtaaaaatatttctcttgttctatat 148161 AP001533.4 >5941 ............................................................ 6000 AP000872.5 >148162 catccaagttggtgtaatttaaatcttattttaaaaaaacaactaattctaccgtacaat 148221 AP001533.4 >6001 ............................................................ 6060 AP000872.5 >148222 tctgctaaaatggatttaacaaattaaggaatttaaaatttaaatgaggccgggcgcggt 148281 AP001533.4 >6061 ............................................................ 6120 AP000872.5 >148282 ggctcacgcctgtaatcccagcactttggaaggccgaggcgggcggatcacgaggtcagg 148341 AP001533.4 >6121 ............................................................ 6180 AP000872.5 >148342 agatcgagaccatcctggctaacacggtgaaaccccatctctactaaaaatacaaaaagt 148401 AP001533.4 >6181 ............................................................ 6240 AP000872.5 >148402 tggccagggggcgtggtggcgggcgcctgtagtcccagctactcgggaggctgaggcagg 148461 AP001533.4 >6241 ............................................................ 6300 AP000872.5 >148462 agaatggcgtgaacccgggaggcggagcttgcagtgagccgagatcgcgccactgcactc 148521 AP001533.4 >6301 ............................................................ 6360 AP000872.5 >148522 cagcctgggcaacaagcaagactccatctcaaaaaaaaaaaaaaaaaattaaatgatata 148581 AP001533.4 >6361 ............................................................ 6420 AP000872.5 >148582 tgtatatatatatgtgacgtaacttcaaaatttaaatgtgatatatcctgcatgttttct 148641 AP001533.4 >6421 ............................................................ 6480 AP000872.5 >148642 ctttgtctaaaatgtggcccaactttaaatattttcaacagaaatgcttagtgtctaaat 148701 AP001533.4 >6481 ............................................................ 6540 AP000872.5 >148702 ctgtattacctttatataagtattatatggttacttatcttaaccttctgctacataaac 148761 AP001533.4 >6541 ............................................................ 6600 AP000872.5 >148762 atgaaaacattcagataaaataaggaagctttgaaatagaacattaagtcatcaattata 148821 AP001533.4 >6601 ............................................................ 6660 AP000872.5 >148822 tcagaactatttaatataatgaaaatactgagaatatgattttatccccagagttccaac 148881 AP001533.4 >6661 ............................................................ 6720 AP000872.5 >148882 tattaaaaaaacattccagggcggagggctaggggagggatagcattaggagaaatacct 148941 AP001533.4 >6721 ............................................................ 6780 AP000872.5 >148942 aatgtagatgacgggttgatgggtgcagcaaaccaccatggaacatgtatacctatgtaa 149001 AP001533.4 >6781 ............................................................ 6840 AP000872.5 >149002 caaacctgcatgttctgcacgtgtaccccagaacttgaagtataatttaaaaaaaagaag 149061 AP001533.4 >6841 ............................................................ 6900 AP000872.5 >149062 tgtttaaaaaaattcctttccaaatgattcagtgttaaaggttaaatcggaggaactttt 149121 AP001533.4 >6901 ............................................................ 6960 AP000872.5 >149122 gattttcaagaatgatatatttatcataatttatatagcattccctaatatcactgaata 149181 AP001533.4 >6961 ............................................................ 7020 AP000872.5 >149182 aaattttaagatatattttctttaagatgtgtatgtatttttttaaaaaaaccactgtat 149241 AP001533.4 >7021 ............................................................ 7080 AP000872.5 >149242 tatagtaatttctgtagatctaggagctatcagtcaactctttaatccagagtgctatct 149301 AP001533.4 >7081 ............................................................ 7140 AP000872.5 >149302 tctgtcactagacagtttccccaactgcacagaccgtgtcaattacttgcaagaaaatgt 149361 AP001533.4 >7141 ............................................................ 7200 AP000872.5 >149362 tgtctcagaatatatttccagtacttaaatctaaatgcaatttttaatcccaaatttagt 149421 AP001533.4 >7201 ............................................................ 7260 AP000872.5 >149422 aggagaggagttgagtttcttttgatctctgatgaattccttagcacaggctgtgctgtt 149481 AP001533.4 >7261 ............................................................ 7320 AP000872.5 >149482 gggaaattagtgctgtttatagttgattttcccagaacattgactcccctctccccagtt 149541 AP001533.4 >7321 ............................................................ 7380 AP000872.5 >149542 ttctgtgacagaaacttcttttgttttggaaaaagaaatggtgcaaacgatgtttttcag 149601 AP001533.4 >7381 ............................................................ 7440 AP000872.5 >149602 gttcgtttatttaatttaaaaaattttgtgggggagatggagttttgctctgttgaccag 149661 AP001533.4 >7441 ............................................................ 7500 AP000872.5 >149662 gctgtagtgtagtgcagtggcctgatgtcagctcactgcagcttctgcttcccaggttca 149721 AP001533.4 >7501 ............................................................ 7560 AP000872.5 >149722 agtgattcttgtgcctcagcctcccaagtagctgcgattacaggcgtgcgtcaccaagcc 149781 AP001533.4 >7561 ............................................................ 7620 AP000872.5 >149782 tggctaatttttgtatttttagtagagatggagtttcgccatgatggccaggctggtctc 149841 AP001533.4 >7621 ............................................................ 7680 AP000872.5 >149842 gaactcctaacctgaagtgatccttctgcctaggcctcccaaagtgctgggattacaggc 149901 AP001533.4 >7681 ............................................................ 7740 AP000872.5 >149902 atgagccactgcacctggcatttttcaggtttagtggactgctctgaacctctacttaaa 149961 AP001533.4 >7741 ............................................................ 7800 AP000872.5 >149962 cttctgtacaatgtgactcaggtttagcttgtatagattgctgtatgggtagggaaaatg 150021 AP001533.4 >7801 ............................................................ 7860 AP000872.5 >150022 tatgtaaagttctctaatacaagacttagtgcatagtaggtactcaaatcagtgacagct 150081 AP001533.4 >7861 ............................................................ 7920 AP000872.5 >150082 aaaaaaccagcaacactgatttcaaattgattgttggtttctaataattaggaattgata 150141 AP001533.4 >7921 ............................................................ 7980 AP000872.5 >150142 ttagcatagggtaaaagaagtaggaaaaatgaaattctattaatgaagaaggaatacata 150201 AP001533.4 >7981 ............................................................ 8040 AP000872.5 >150202 catagtatttaattgaatgtaagacactttgatgctagtgatgtcttctaatcttatcac 150261 AP001533.4 >8041 ............................................................ 8100 AP000872.5 >150262 aaggtattaaggaaaagtttttacataactgtatatgacctacttgggacatagcattgt 150321 AP001533.4 >8101 ............................................................ 8160 AP000872.5 >150322 atgataacatgtattacaggatacatcctggttttagatgttataaaatttgaaaatatc 150381 AP001533.4 >8161 ............................................................ 8220 AP000872.5 >150382 aatgaaaaaaaatgacaaatgttttctgccatggaaagaaaaataaaatacactatgtaa 150441 AP001533.4 >8221 ............................................................ 8280 AP000872.5 >150442 aacaataaatattctacccacattatgatatacacaggttaaaagtgattaatgttggat 150501 AP001533.4 >8281 ............................................................ 8340 AP000872.5 >150502 tttattttattctttttaaaacatatttcattcacatgagtcaaattttatttgaaaaaa 150561 AP001533.4 >8341 ............................................................ 8400 AP000872.5 >150562 aatgaattattttagatttccaagctgttcatcatgtgtcaaaacaaggactacataaaa 150621 AP001533.4 >8401 ............................................................ 8460 AP000872.5 >150622 caatatttctcaaagtaaagatcttactttgtgcttctcatattattattattttttgac 150681 AP001533.4 >8461 ............................................................ 8520 AP000872.5 >150682 ttgtcacccaggctggagtgcagcggtgcgatctctggtcactacaacctctgcttcctg 150741 AP001533.4 >8521 ............................................................ 8580 AP000872.5 >150742 cattcaggtgattctccagcctcagcctcccaagtagctgggactacaggcacccaccac 150801 AP001533.4 >8581 ............................................................ 8640 AP000872.5 >150802 cactcccagctgatttttgtgtttttagtagagatggggtttcaccatgttggctaggct 150861 AP001533.4 >8641 ............................................................ 8700 AP000872.5 >150862 ggtctcgaactcctgacctcaggtgatctgcccgcctcggcctcccaaagtgctgggatt 150921 AP001533.4 >8701 ............................................................ 8760 AP000872.5 >150922 acacgcgtgagccaccgcacccggccaataatttgagatgtaaacaatattggagtcctt 150981 AP001533.4 >8761 ............................................................ 8820 AP000872.5 >150982 tagggccaagaaaatacaactttagatttataatctaatcttaactattttataaatagc 151041 AP001533.4 >8821 ............................................................ 8880 AP000872.5 >151042 tttttcattattgttttattcagtatatctcataattcaaaaagttgtttttttcccttt 151101 AP001533.4 >8881 ............................................................ 8940 AP000872.5 >151102 gtatatacttaaaaacattatttaatggggagggtagttaggctagagtcataaaaatga 151161 AP001533.4 >8941 ............................................................ 9000 AP000872.5 >151162 gataaatttggttagtccaatctgtcccatgcagaaactatttcaggtacagaaactgaa 151221 AP001533.4 >9001 ............................................................ 9060 AP000872.5 >151222 aaattgtggctattcagattgagaattttgttgattaatatcctatttttttcacttgta 151281 AP001533.4 >9061 ............................................................ 9120 AP000872.5 >151282 acagtctatccttgacctcctttgctgaaaaaatttactactttgataattactatgctg 151341 AP001533.4 >9121 ............................................................ 9180 AP000872.5 >151342 ctgaatttcccatgacctaaaatattaaaaattatttttactagtttatataatataaaa 151401 AP001533.4 >9181 ............................................................ 9240 AP000872.5 >151402 gtttaggccaggtgcagtggttcacacctgtaatcccagaactttgggaggccaaggcag 151461 AP001533.4 >9241 ............................................................ 9300 AP000872.5 >151462 gcagatcacaaggtcaggagattgagaccatcctggccaacatggtgaaaccctgtctct 151521 AP001533.4 >9301 ............................................................ 9360 AP000872.5 >151522 actaaaaatacaaaaattagctgggcctggtggtgtacacctgtagtcccagctacttgg 151581 AP001533.4 >9361 ............................................................ 9420 AP000872.5 >151582 gaggctgaggcaagagaatcgcttgagcccgggaagtggaggttgcagtgagccgaaatc 151641 AP001533.4 >9421 ............................................................ 9480 AP000872.5 >151642 gtgccactgcactccagcctgggtgacagagcaagactccatctcaaaaaaaaaaaaaaa 151701 AP001533.4 >9481 ............................................................ 9540 AP000872.5 >151702 aagtttaatatcttttgtacctttaatcatttatgtattaaggaaaaagccacttaattt 151761 AP001533.4 >9541 ............................................................ 9600 AP000872.5 >151762 ggatgaaacaccaaaatagtgcttgctatgtcacacactgctctaagtttatttttctta 151821 AP001533.4 >9601 ............................................................ 9660 AP000872.5 >151822 tactgatttcatccttataacaaccctatgaaacaagtactattgttatatccattttac 151881 AP001533.4 >9661 ............................................................ 9720 AP000872.5 >151882 agataagaaaactaaggcagagagtgaaagtatgttgcaaggtcacatagttagcaagtg 151941 AP001533.4 >9721 ............................................................ 9780 AP000872.5 >151942 gtacagcctgaaatgagattgagaaggtgtagctccagagcatatattcttactatactg 152001 AP001533.4 >9781 ............................................................ 9840 AP000872.5 >152002 ctttcttatatcacagcataattacgggtagctgacataattcagacataaaaatacttt 152061 AP001533.4 >9841 ............................................................ 9900 AP000872.5 >152062 gctttttcatagagtacctaagttgtttaagctttatgaattccaaattgctcacaaata 152121 AP001533.4 >9901 ............................................................ 9960 AP000872.5 >152122 actggtcatggatctctgcatattatagttattctacttgtttggattcaatcatttata 152181 AP001533.4 >9961 ............................................................ 10020 AP000872.5 >152182 agatgggattaaacttcatctgattaggtaaatacaacctcctgccattaaaatatagct 152241 AP001533.4 >10021 ............................................................ 10080 AP000872.5 >152242 ttaaaaaacttgatctttgatattaagtatttattcatgattagtgtagagagagctata 152301 AP001533.4 >10081 ............................................................ 10140 AP000872.5 >152302 ctcttagtttgttatagtgactccatacagtgacatatagtgacacaagggaaaagtctc 152361 AP001533.4 >10141 ............................................................ 10200 AP000872.5 >152362 atgtgcgttgacattcacagccacttgccacattttctctttattcattagttaactttg 152421 AP001533.4 >10201 ............................................................ 10260 AP000872.5 >152422 attggaaaaactccaccaaccatcagaatcaagtatttataaaaaacagcatgttgtttc 152481 AP001533.4 >10261 ............................................................ 10320 AP000872.5 >152482 ataggtaaatacgaagtttctcaaccgtatttacatttgtaaatctgaatatggtggcat 152541 AP001533.4 >10321 ............................................................ 10380 AP000872.5 >152542 gttttaaaaaccgaaaacatggtattaaccaggaaaaaatagtgtttaagtgataggaaa 152601 AP001533.4 >10381 ............................................................ 10440 AP000872.5 >152602 aatgatccaataaagctttccagattttccagtctattccaaatctagttgattcaataa 152661 AP001533.4 >10441 ............................................................ 10500 AP000872.5 >152662 gaaacaagtattttgacatttcaaacaataatatgtggcattgtatcaactcaaacttac 152721 AP001533.4 >10501 ............................................................ 10560 AP000872.5 >152722 agcaagaatcctgttccactcatttatctttgtgtctccaagacctaacatggttctgag 152781 AP001533.4 >10561 ............................................................ 10620 AP000872.5 >152782 gtaaaagatcaccaggacttgttttcatgaccctgctgatcaaaaacaggatgtagctaa 152841 AP001533.4 >10621 ............................................................ 10680 AP000872.5 >152842 gaaactggcccaaatcagctaggactagaaattataatgcatctgcaggctatgagacac 152901 AP001533.4 >10681 ............................................................ 10740 AP000872.5 >152902 tgcaccagcaccatgacactttacaaatgccatgggaacacccagaaattaagttatata 152961 AP001533.4 >10741 ............................................................ 10800 AP000872.5 >152962 gttccaagaactccctgcagcttttccagaaaatctgtgaataacagacctcatatttag 153021 AP001533.4 >10801 ............................................................ 10860 AP000872.5 >153022 catataattaagagttggtatacatatagctagccagcaacccacgagggctactctgcc 153081 AP001533.4 >10861 ............................................................ 10920 AP000872.5 >153082 tgtggagtagccattttgctggatgctgttgctccaataaacttggcttctttcactgtg 153141 AP001533.4 >10921 ............................................................ 10980 AP000872.5 >153142 ggttccctcttgaattcttttctgaattaagccaaaaatcctcccaagctgagcccccat 153201 AP001533.4 >10981 ............................................................ 11040 AP000872.5 >153202 tttagggtttgcctgcatcagttccttatagaatttaggcatttattttatttactaaag 153261 AP001533.4 >11041 ............................................................ 11100 AP000872.5 >153262 gagcatatttgtatatttctagagctatactaaattatattcctagtaatgaaaccaatg 153321 AP001533.4 >11101 ............................................................ 11160 AP000872.5 >153322 tagtctgaaatactttgttattacaagtagaatatcattcaccttaatgtgaaatgcatt 153381 AP001533.4 >11161 ............................................................ 11220 AP000872.5 >153382 aaatttcatatgaaaattcttgtataataccaaactttttaatcaatgtgaatagccaaa 153441 AP001533.4 >11221 ............................................................ 11280 AP000872.5 >153442 acagtatattattgaatctcactagatgtcagttgattgtattttgtctttctgattgaa 153501 AP001533.4 >11281 ............................................................ 11340 AP000872.5 >153502 acactgtgtagttggtttcaacttgattgcctgagaatcactctttgctttgctaaaatg 153561 AP001533.4 >11341 ............................................................ 11400 AP000872.5 >153562 catacccagtcaaggatattttctctataatgccaaatcttccatataaatatctcacct 153621 AP001533.4 >11401 ............................................................ 11460 AP000872.5 >153622 tatgccacatacagtattgtacaaattgaaatgttggttataaattttaaatgactggta 153681 AP001533.4 >11461 ............................................................ 11520 AP000872.5 >153682 aagaatgtactactgatgattagtgtgtgtcttgtatgtaattgtattgaggttttagat 153741 AP001533.4 >11521 ............................................................ 11580 AP000872.5 >153742 gctataattcattaataaagagagatatagaaattagtttattctttattatcacacaga 153801 AP001533.4 >11581 ............................................................ 11640 AP000872.5 >153802 ataacaagaattagagttaaattcacaatatttttaaagaaaacattatgtgaagatgat 153861 AP001533.4 >11641 ............................................................ 11700 AP000872.5 >153862 tcatttcaaaccaccagccaatttaacataaaacacttgtcaagctgagtagactgtttt 153921 AP001533.4 >11701 ............................................................ 11760 AP000872.5 >153922 cttatgtgaaccacaaaatattttctctgaaatctacacttagtttaaaaacagagatgg 153981 AP001533.4 >11761 ............................................................ 11820 AP000872.5 >153982 gattttgcatattagcttgaaaataagtatatgatgatgatattaggtgcccactagcac 154041 AP001533.4 >11821 ............................................................ 11880 AP000872.5 >154042 ctagtttttacagctttgcattgtcaccccatcactgccagggacccagccccaggcata 154101 AP001533.4 >11881 ............................................................ 11940 AP000872.5 >154102 cacagatgaaaggacagtttcaccttcttggcaaaaaccttcagaacaattgtcaacata 154161 AP001533.4 >11941 ............................................................ 12000 AP000872.5 >154162 ctctcaaatgtctttcccactcagaaatgaggagcaaggtgtatgactttagattcaaga 154221 AP001533.4 >12001 ............................................................ 12060 AP000872.5 >154222 agtatatggggctaaatatctttaaaagtataactctggacaatgtacttagggacctac 154281 AP001533.4 >12061 ............................................................ 12120 AP000872.5 >154282 tacttactcaaaatagggtagtagcattaataactaaatagggcgtgagtcatgagaaag 154341 AP001533.4 >12121 ............................................................ 12180 AP000872.5 >154342 attccctgcatctcttgccaagtattaacactagttttactaataagcaacggggtagat 154401 AP001533.4 >12181 ............................................................ 12240 AP000872.5 >154402 aactttgaagattgcatcaacttcaacacaaaaaaatgtgaatatctaccatgtgcaaaa 154461 AP001533.4 >12241 ............................................................ 12300 AP000872.5 >154462 cagtcaaagtatgttaggggaaatttaaaacattacatagaaaataagtatgtgatgata 154521 AP001533.4 >12301 ............................................................ 12360 AP000872.5 >154522 tcgttaaaatacatgatcacttaatttttacagttttgcatctgttaccagccagtgcca 154581 AP001533.4 >12361 ............................................................ 12420 AP000872.5 >154582 ggagaactgtcaggcacacatggatagatgaagagtctcaccctcttgacagaaaacctc 154641 AP001533.4 >12421 ............................................................ 12480 AP000872.5 >154642 atatgaatacccaaaccactttgaaagtatgtgctcaactgaaataattaatctttgtgt 154701 AP001533.4 >12481 ............................................................ 12540 AP000872.5 >154702 ttttctctttggcactggacctttctcctggtcagttggaggcaggcatattgctctgag 154761 AP001533.4 >12541 ............................................................ 12600 AP000872.5 >154762 gagaattggaattgttatagcggaaatgttcaaagaaagtcaacattcagcttttgactt 154821 AP001533.4 >12601 ............................................................ 12660 AP000872.5 >154822 cctcagttggtctttgaaatccacagaaaggcaagtctggagattagggctttctcaagc 154881 AP001533.4 >12661 ............................................................ 12720 AP000872.5 >154882 gaaaaacatggtctaaatctcaaaggtatccttaaaaggtggacttaagcatcaaaagct 154941 AP001533.4 >12721 ............................................................ 12780 AP000872.5 >154942 actaggactagatgagaactcattctaaaacctgacagaagcctccagcacatagcaaga 155001 AP001533.4 >12781 ............................................................ 12840 AP000872.5 >155002 ggaagtgagaggctttcatgattcagaagaaggaagatgtagggcaaagaggacaaatgc 155061 AP001533.4 >12841 ............................................................ 12900 AP000872.5 >155062 ctacattctgagactgaaagttgaaggaggtgagattcagacaagtaaagggaagtccag 155121 AP001533.4 >12901 ............................................................ 12960 AP000872.5 >155122 gaagatcaagccttttatgcttgcctgtaaagtctgcaacatcttagagaagcttggatt 155181 AP001533.4 >12961 ............................................................ 13020 AP000872.5 >155182 tagtgtggtggcagctgagtggaggcttagcaggcagtggtaagccatggctctcctgaa 155241 AP001533.4 >13021 ............................................................ 13080 AP000872.5 >155242 ggggcaaggtgactccacagcagggccagatgagaaaagagctgggcctatgaggaatgt 155301 AP001533.4 >13081 ............................................................ 13140 AP000872.5 >155302 gctaagccagcaagaaatggaagttagcaaagtcccagcactctgcagtgctgaagctga 155361 AP001533.4 >13141 ............................................................ 13200 AP000872.5 >155362 aagaatagataaattcacaagccaaagacttaaatatgagatgatagcaacgggggtcta 155421 AP001533.4 >13201 ............................................................ 13260 AP000872.5 >155422 tgaccaggcataactaacaagggactggtgtatggccagtgaggacctggagaaagaaac 155481 AP001533.4 >13261 ............................................................ 13320 AP000872.5 >155482 ctccttcccacagctaccatgtacatacagtaagcttctgccttcccagctgctgtctgg 155541 AP001533.4 >13321 ............................................................ 13380 AP000872.5 >155542 ttagtggaactaacaatttccttgatggaaattgaataaggtaatccaaaaagaaggctc 155601 AP001533.4 >13381 ............................................................ 13440 AP000872.5 >155602 ttttagatgaaaaaacatggatagattattaagcgccaagttttctcttcaacctactgc 155661 AP001533.4 >13441 ............................................................ 13500 AP000872.5 >155662 tcaccagtgctccctcctcagctccaaggctgtggagggctcatgaagtcacaatgttct 155721 AP001533.4 >13501 ............................................................ 13560 AP000872.5 >155722 actgagaatttagctttttttttttttttggagtgggtataccattttgtaattccactt 155781 AP001533.4 >13561 ............................................................ 13620 AP000872.5 >155782 gataatggcatctgattatttgatcatgacatcattatttgtatacaatgcagcaagaat 155841 AP001533.4 >13621 ............................................................ 13680 AP000872.5 >155842 tttgtttttaatgtaggcttttaaatgggctttgatggaacttggttccatagaaggaat 155901 AP001533.4 >13681 ............................................................ 13740 AP000872.5 >155902 cccagataaggctttttaaaagccgagcccagccatggattcataccatcaaatacctat 155961 AP001533.4 >13741 ............................................................ 13800 AP000872.5 >155962 gagttaggtgaattcctctcgaggttccaagaatctatacaaagaatgtgtttattttgt 156021 AP001533.4 >13801 ............................................................ 13860 AP000872.5 >156022 atgggttcagcacaactcagttcctctttctcattttctgaaacttgaactgctctagtc 156081 AP001533.4 >13861 ............................................................ 13920 AP000872.5 >156082 ttacccgtgtgtatagacctggactttgaggttggacagacatgcaaaggtagggatata 156141 AP001533.4 >13921 ............................................................ 13980 AP000872.5 >156142 ggtggagtggtacagattgtttggacagatagaattctgggacttgggaaaactaagttt 156201 AP001533.4 >13981 ............................................................ 14040 AP000872.5 >156202 tgtagtttttggtttcctgatgaaaaatttgtaatttcaacacataagcaaaataattag 156261 AP001533.4 >14041 ............................................................ 14100 AP000872.5 >156262 acatctggccttgtgtttgacaatttatatggtgtatttcatctcctttcgtcagtcctg 156321 AP001533.4 >14101 ............................................................ 14160 AP000872.5 >156322 tcaatgttcctatgttatatcttccaaaacccttctggaaaattagagaggaggtcatga 156381 AP001533.4 >14161 ............................................................ 14220 AP000872.5 >156382 tcacctacaattcttcatgtttatgatcatcattttcaccaaaatagtgcaacttcctca 156441 AP001533.4 >14221 ............................................................ 14280 AP000872.5 >156442 aaaatgttctccctgcttccaggattagtcatctccaactttattctccatattccagtg 156501 AP001533.4 >14281 ............................................................ 14340 AP000872.5 >156502 ggagtcttctaaaatattcatatgaattgtgctgctttcctgtttacaacagaatcaagt 156561 AP001533.4 >14341 ............................................................ 14400 AP000872.5 >156562 ctacactctttaacatggtgtacaaggccactgattatctagacctggctttcttcttca 156621 AP001533.4 >14401 ............................................................ 14460 AP000872.5 >156622 gtctcatcatccatccccaccccacattctctctccccatcaggtttgtgcaaatgttgt 156681 AP001533.4 >14461 ............................................................ 14520 AP000872.5 >156682 ttgggatactcttctctctttggaatccctcctgtttggaatactcttctcttcttgcct 156741 AP001533.4 >14521 ............................................................ 14580 AP000872.5 >156742 ttggcatctcctcaccacgcacgttctgctaattcctaaactgcttatagattgtggctt 156801 AP001533.4 >14581 ............................................................ 14640 AP000872.5 >156802 agctttgacttttttcaggatgcctctgctaacccctaaattcaaggtaggtgctcctct 156861 AP001533.4 >14641 ............................................................ 14700 AP000872.5 >156862 taggtgctccaatagttccctgtacttcctccagcataagcattcacagtacaatattgt 156921 AP001533.4 >14701 ............................................................ 14760 AP000872.5 >156922 agctatctgtttacctgtctttattccccatccaactctaagctcggagaagacgggaac 156981 AP001533.4 >14761 ............................................................ 14820 AP000872.5 >156982 actggtaatctccacaatctagcagagtgactggcatacagcacagtaaaggcttcacag 157041 AP001533.4 >14821 ............................................................ 14880 AP000872.5 >157042 ctagttgctgaggaataaaatgatgcctaaagtaagacttttcaacaaaaaataattaat 157101 AP001533.4 >14881 ............................................................ 14940 AP000872.5 >157102 ttaatgttttagagagccctccatgtaacttttgtaaatcatatttaatcctctcaaaat 157161 AP001533.4 >14941 ............................................................ 15000 AP000872.5 >157162 acaaagaactttgatattttcttctgtttctttcaaatttcagtaaaaaggctttaactt 157221 AP001533.4 >15001 ............................................................ 15060 AP000872.5 >157222 aaaccctttgtgctgatttttcttataaacatgcacaactcagaaaagttaaaatacaca 157281 AP001533.4 >15061 ............................................................ 15120 AP000872.5 >157282 gaatactaagatcaaaaggagatactttactggctaaagtgaagaattc 157330 AP001533.4 >15121 ................................................. 15169
Type | Point1 | Point2 | Orient1 | Orient2 | Curator | Comment | Time |
L | 142161 | 1 | + | + | chenhc | Taxid 9606 chrom 11 Reference assembly | 2008-08-08 12:38:51.560 |
A | 157330 | 15170 | + | + | chenhc | Taxid 9606 chrom 11 Reference assembly | 2008-11-11 11:57:19.663 |
Id | Type | Date | Whodid | Comment |
88333 | InitHasAlign | 10/01/2006 02:11:56 | jcherry | blast parameters: -W 28 -r 1 -q -3 -e 1e-5 -Z 200 -F 'm L; R' bandwidths: 501 701 1001 5001 Toolkit wrapper version: built Thu Aug 17 17:58:09 EDT 2006 using /netopt/ncbi_tools/c++.by-date/production/20060730 Running blast for AP000872.5 and AP001533.4 Found 1 acceptable dovetail alignment(s) by blast -W 28 -r 1 -q -3 -e 1e-5 -Z 200 -F 'm L; R' |
127427 | CreateSwitchPt | 08/08/2008 12:38:51 | chenhc | From Hs build 36.1 agp files |
88334 | ReSetShortOvlp | 09/04/2008 10:31:48 | dbo | |
110023 | ReRunFndOvlp | 09/11/2008 09:24:11 | cgi_chen | blast parameters: -W 28 -r 1 -q -3 -e 1e-5 -Z 200 -F 'm L; R' bandwidths: 501 701 1001 5001 Toolkit version: API built on Sep 2 2008 using /opt/ncbi/32/c++.by-date/production/20080302/GCC342-Release/lib:/netopt/ncbi_tools/c++.by-date/production/20080302/GCC342-Release/lib Running blast for 14189746 and 14245763 Found 1 acceptable dovetail alignment(s) by blast -W 28 -r 1 -q -3 -e 1e-5 -Z 200 -F 'm L; R' from TPF submission |
153640 | CreateSwitchPt | 11/11/2008 11:57:19 | chenhc | contig_builder 1.3 Toolkit wrapper version: built Nov 10 2008 using /netopt/ncbi_tools64/c++.by-date/20081110/GCC401-Release64/lib |
Clone | R | F | ||||
---|---|---|---|---|---|---|
Accession | %id | Position (strand) | Accession | %id | Position (strand) | |
CH17-100H09 | AP001533.4 | 98.04% | pos 158725 (R-) | |||
CH17-134B17 | AP001533.4 | 97.39% | pos 115540 (R+) | |||
CH17-143M20 | AP000872.5 | 97.32% | pos 72139 (R+) | AP001533.4 | 99.02% | pos 124629 (F-) |
CH17-159E11 | AP000872.5 | 99.04% | pos 121238 (R-) | |||
CH17-180C18 | AP000872.5 | 99.13% | pos 142132 (R-) | |||
CH17-223J21 | AP001533.4 | 97.77% | pos 143007 (R+) | |||
CH17-241A06 | AP001533.4 | 99.76% | pos 158832 (F+) | |||
CH17-252L19 | AP001533.4 | 99.32% | pos 194886 (R+) | |||
CH17-258G22 | AP000872.5 | 98.8% | pos 146542 (F-) | |||
AP000872.5 | 98.92% | pos 146476 (F-) | ||||
AP001533.4 | 98.8% | pos 4381 (F-) | ||||
AP001533.4 | 98.92% | pos 4315 (F-) | ||||
CH17-259G19 | AP000872.5 | 99.25% | pos 51886 (F-) | |||
CH17-293L14 | AP001533.4 | 98.52% | pos 194876 (R+) | |||
CH17-296M08 | AP000872.5 | 97.8% | pos 88299 (F-) | |||
AP000872.5 | 98.27% | pos 88311 (F-) | ||||
CH17-308B11 | AP000872.5 | 98.89% | pos 6115 (R+) | AP001533.4 | 99.2% | pos 112859 (F-) |
CH17-321C09 | AP001533.4 | 98.92% | pos 207164 (R-) | AP000872.5 | 99.37% | pos 146588 (F+) |
AP001533.4 | 99.37% | pos 4427 (F+) | ||||
CH17-360P12 | AP001533.4 | 99.61% | pos 82192 (R-) | AP000872.5 | 98.57% | pos 32080 (F+) |
CH17-361P01 | AP000872.5 | 99.41% | pos 156104 (R+) | |||
AP001533.4 | 99.41% | pos 13943 (R+) | ||||
CH17-37E13 | AP001533.4 | 99.37% | pos 175063 (R+) | |||
CH17-411E13 | AP001533.4 | 97.39% | pos 17853 (F+) | |||
CH17-453B10 | AP000872.5 | 99.64% | pos 33226 (F-) | |||
CH17-462I15 | AP001533.4 | 98.5% | pos 83021 (R+) | |||
CH17-472G11 | AP000872.5 | 99.53% | pos 94983 (F-) | |||
CH17-477N16 | AP000872.5 | 99.09% | pos 157307 (F-) | |||
AP000872.5 | 99.85% | pos 157308 (F-) | ||||
AP001533.4 | 99.09% | pos 15146 (F-) | ||||
AP001533.4 | 99.85% | pos 15147 (F-) | ||||
CH17-61H12 | AP000872.5 | 97.85% | pos 72233 (F-) | |||
CH17-64E16 | AP001533.4 | 99.53% | pos 123483 (F+) | |||
CH17-82P22 | AP001533.4 | 99.61% | pos 143662 (F-) | |||
CTC-782C22 | AP001533.4 | 99.5% | pos 171233 (R-) | AP001533.4 | 99.52% | pos 61985 (F+) |
CTD-2006D7 | AP001533.4 | 98.06% | pos 170167 (R-) | |||
AP001533.4 | 99.03% | pos 170164 (R-) | ||||
CTD-2016F19 | AP000872.5 | 98.86% | pos 54414 (R+) | AP001533.4 | 97.58% | pos 81042 (F-) |
CTD-2165K15 | AP000872.5 | 98.77% | pos 46480 (F-) | |||
AP000872.5 | 99.3% | pos 46471 (F-) | ||||
CTD-2177F7 | AP001533.4 | 99.74% | pos 200495 (F+) | |||
CTD-2273I13 | AP000872.5 | 97.85% | pos 33365 (R+) | AP000872.5 | 97.95% | pos 135101 (F-) |
CTD-2324E16 | AP001533.4 | 99.74% | pos 180602 (R+) | |||
CTD-2328G9 | AP000872.5 | 99.49% | pos 76217 (R+) | AP001533.4 | 99.02% | pos 47196 (F-) |
AP000872.5 | 99.55% | pos 76217 (R+) | ||||
CTD-2384F10 | AP001533.4 | 100% | pos 60840 (R+) | |||
CTD-2385F10 | AP001533.4 | 99.39% | pos 60810 (R+) | |||
CTD-2501G16 | AP001533.4 | 99.44% | pos 17777 (F-) | |||
CTD-2522E1 | AP000872.5 | 98.76% | pos 95111 (R+) | AP001533.4 | 99.61% | pos 173786 (F-) |
CTD-3050P16 | AP001533.4 | 98.18% | pos 133199 (F-) | |||
CTD-3055K12 | AP001533.4 | 99.61% | pos 143888 (R-) | AP001533.4 | 100% | pos 116856 (F+) |
CTD-3078L23 | AP001533.4 | 98.94% | pos 142978 (R+) | AP001533.4 | 99.77% | pos 149503 (F-) |
CTD-3135A4 | AP001533.4 | 99.03% | pos 176366 (F+) | |||
CTD-3188J3 | AP001533.4 | 99.77% | pos 144019 (R-) | |||
CTD-3228F4 | AP000872.5 | 98.73% | pos 99852 (F-) | |||
RP11-1003E5 | AP000872.5 | 98.06% | pos 99883 (R-) | |||
RP11-1113O10 | AP000872.5 | 98.94% | pos 51877 (R-) | |||
RP11-1147C14 | AP001533.4 | 100% | pos 60874 (R-) | AP000872.5 | 98.77% | pos 47748 (F+) |
RP11-152E11 | AP001533.4 | 97.95% | pos 143003 (R+) | |||
RP11-236L10 | AP001533.4 | 99.8% | pos 194864 (R+) | |||
RP11-23H2 | AP001533.4 | 100% | pos 158810 (R+) | |||
RP11-265O1 | AP000872.5 | 99.46% | pos 51873 (F-) | |||
RP11-343P20 | AP000872.5 | 99.56% | pos 90628 (R-) | |||
RP11-418N14 | AP001533.4 | 100% | pos 207177 (R-) | AP000872.5 | 99.21% | pos 128913 (F+) |
RP11-599H8 | AP000872.5 | 99.36% | pos 120404 (R+) | AP001533.4 | 99.58% | pos 133190 (F-) |
RP11-714B8 | AP000872.5 | 97.57% | pos 146562 (R-) | |||
AP001533.4 | 97.57% | pos 4401 (R-) | ||||
RP11-727A20 | AP000872.5 | 97.17% | pos 157329 (R-) | |||
AP001533.4 | 97.17% | pos 15168 (R-) | ||||
RP11-762M1 | AP001533.4 | 99.75% | pos 181058 (R-) | AP001533.4 | 98.64% | pos 17788 (F+) |
RP11-887G14 | AP001533.4 | 97.53% | pos 194846 (F+) |
Clone | R | F | ||||
---|---|---|---|---|---|---|
Accession | %id | Position (strand) | Accession | %id | Position (strand) | |
ABC10-1583170I2 | AP000872.5 | 97.29% | pos 130844 (F-) | |||
ABC10-1585070G21 | AP001533.4 | 98.12% | pos 66821 (R-) | AP001533.4 | 99.03% | pos 24207 (F+) |
ABC10-1586170I6 | AP001533.4 | 99.34% | pos 197936 (R-) | AP001533.4 | 98.93% | pos 156205 (F+) |
ABC10-1615570C9 | AP000872.5 | 98.41% | pos 7597 (R+) | AP000872.5 | 99.39% | pos 48725 (F-) |
ABC10-43624100G11 | AP001533.4 | 99.49% | pos 158924 (R-) | AP001533.4 | 99.56% | pos 118049 (F+) |
ABC10-43667400C19 | AP000872.5 | 99.68% | pos 103531 (R-) | AP000872.5 | 99.02% | pos 63501 (F+) |
ABC10-43668400I15 | AP001533.4 | 99.23% | pos 23162 (R+) | AP001533.4 | 99.38% | pos 62286 (F-) |
ABC10-43668700E20 | AP001533.4 | 99.33% | pos 178660 (F+) | |||
ABC10-44082400L2 | AP000872.5 | 99.73% | pos 44700 (R-) | AP000872.5 | 100% | pos 1617 (F+) |
ABC10-44092500J19 | AP001533.4 | 99.69% | pos 102974 (R-) | AP001533.4 | 100% | pos 60631 (F+) |
ABC10-44419500A12 | AP001533.4 | 98.95% | pos 34624 (R-) | AP000872.5 | 99.78% | pos 135341 (F+) |
ABC10-44421100C19 | AP001533.4 | 100% | pos 197862 (R+) | |||
ABC10-44450100D18 | AP001533.4 | 99.72% | pos 78846 (R-) | AP001533.4 | 99.85% | pos 38200 (F+) |
ABC10-44452700A18 | AP000872.5 | 99.85% | pos 59676 (R-) | AP000872.5 | 100% | pos 18274 (F+) |
ABC10-44454500P13 | AP001533.4 | 100% | pos 81956 (R+) | AP001533.4 | 99.46% | pos 123842 (F-) |
ABC10-44455500D10 | AP001533.4 | 100% | pos 119523 (R-) | AP001533.4 | 100% | pos 80722 (F+) |
ABC10-44462100E3 | AP000872.5 | 99.88% | pos 49628 (R+) | AP000872.5 | 99.4% | pos 92987 (F-) |
ABC10-44472900J19 | AP001533.4 | 99.37% | pos 196123 (R+) | |||
ABC10-44482000N20 | AP001533.4 | 99.68% | pos 163753 (R-) | AP001533.4 | 100% | pos 122420 (F+) |
ABC10-44482100I7 | AP001533.4 | 99.21% | pos 189592 (R+) | |||
ABC10-44491100G5 | AP000872.5 | 99.86% | pos 103525 (R-) | AP000872.5 | 98.81% | pos 63545 (F+) |
ABC10-44491100J9 | AP001533.4 | 99.29% | pos 134212 (R-) | AP001533.4 | 100% | pos 93275 (F+) |
ABC10-44495500F8 | AP000872.5 | 99.61% | pos 140286 (R-) | AP000872.5 | 99.59% | pos 98104 (F+) |
ABC10-44498000M2 | AP000872.5 | 100% | pos 33069 (R-) | |||
ABC10-44503100I4 | AP001533.4 | 100% | pos 85256 (R-) | AP001533.4 | 99.2% | pos 40962 (F+) |
ABC10-44508700E15 | AP001533.4 | 99.86% | pos 45083 (R+) | AP001533.4 | 99.87% | pos 84688 (F-) |
ABC10-44519700J3 | AP001533.4 | 99.84% | pos 170834 (R+) | |||
ABC10-44529100B8 | AP001533.4 | 100% | pos 183662 (F+) | |||
ABC10-44529600I22 | AP001533.4 | 99.69% | pos 150637 (R+) | AP001533.4 | 99.72% | pos 194386 (F-) |
ABC10-44536900A21 | AP000872.5 | 99.72% | pos 19293 (R+) | AP000872.5 | 99.84% | pos 60794 (F-) |
ABC10-44543000E15 | AP000872.5 | 99.83% | pos 78460 (R+) | AP000872.5 | 99.6% | pos 121292 (F-) |
ABC10-44543300L14 | AP001533.4 | 100% | pos 192689 (R-) | AP001533.4 | 100% | pos 152382 (F+) |
ABC10-44543900L13 | AP000872.5 | 99.86% | pos 1722 (R-) | |||
ABC10-44544100N6 | AP001533.4 | 99.83% | pos 150862 (R+) | AP001533.4 | 99.85% | pos 194053 (F-) |
ABC10-44552400B14 | AP000872.5 | 98.15% | pos 71536 (R-) | AP000872.5 | 99.59% | pos 33674 (F+) |
ABC10-44553100N16 | AP000872.5 | 99.17% | pos 117064 (R+) | AP001533.4 | 100% | pos 17355 (F-) |
ABC10-44554700D9 | AP001533.4 | 100% | pos 45194 (R+) | AP001533.4 | 99.66% | pos 84695 (F-) |
ABC10-44554800E14 | AP001533.4 | 100% | pos 32600 (R+) | AP001533.4 | 99.47% | pos 74057 (F-) |
ABC10-44556000F20 | AP001533.4 | 99.41% | pos 34639 (R-) | AP000872.5 | 99.66% | pos 135347 (F+) |
ABC10-44559300G3 | AP000872.5 | 100% | pos 117072 (R+) | AP001533.4 | 100% | pos 17384 (F-) |
ABC10-44564900L11 | AP001533.4 | 99.7% | pos 169380 (R+) | |||
ABC10-44565200J5 | AP000872.5 | 100% | pos 2577 (F-) | |||
ABC10-44567500O19 | AP001533.4 | 99.72% | pos 134368 (R-) | AP001533.4 | 99.05% | pos 96358 (F+) |
ABC10-44586000D4 | AP001533.4 | 99.44% | pos 89805 (R-) | AP001533.4 | 99.18% | pos 50009 (F+) |
ABC10-44634600P14 | AP001533.4 | 97.96% | pos 58568 (R-) | AP001533.4 | 99.55% | pos 18556 (F+) |
ABC10-44635200N21 | AP001533.4 | 99.36% | pos 150637 (R+) | |||
ABC10-44684800L2 | AP001533.4 | 99.76% | pos 192681 (R-) | AP001533.4 | 99.29% | pos 152400 (F+) |
ABC10-44708200A16 | AP001533.4 | 99.47% | pos 134354 (R-) | AP001533.4 | 99.43% | pos 96376 (F+) |
ABC10-44714500F22 | AP000872.5 | 99.16% | pos 7293 (R-) | |||
ABC10-44768200E19 | AP000872.5 | 100% | pos 50522 (F-) | |||
ABC10-44768600I19 | AP001533.4 | 99.18% | pos 179607 (R+) | |||
ABC10-45498500F24 | AP001533.4 | 98.74% | pos 191528 (R+) | |||
ABC10-45505200D4 | AP000872.5 | 99.26% | pos 18514 (F-) | |||
ABC10-45505500E5 | AP000872.5 | 99.42% | pos 11803 (R+) | AP000872.5 | 99.18% | pos 53918 (F-) |
ABC10-45510100A8 | AP001533.4 | 99.46% | pos 196115 (R+) | |||
ABC10-45520100K8 | AP001533.4 | 98.37% | pos 71214 (R-) | AP001533.4 | 98.81% | pos 29589 (F+) |
ABC10-45523300K9 | AP001533.4 | 99.49% | pos 187507 (F+) | |||
ABC10-45523500I11 | AP000872.5 | 99.84% | pos 74730 (R+) | AP000872.5 | 98.67% | pos 117462 (F-) |
ABC10-45526500M16 | AP000872.5 | 99.68% | pos 88566 (R+) | AP000872.5 | 99.45% | pos 128375 (F-) |
ABC10-45533500B9 | AP001533.4 | 99.59% | pos 119523 (R-) | AP001533.4 | 99.73% | pos 80669 (F+) |
ABC10-45543800N18 | AP000872.5 | 99.33% | pos 118467 (R+) | AP000872.5 | 99.85% | pos 157291 (F-) |
AP001533.4 | 99.85% | pos 15130 (F-) | ||||
ABC10-45546000C17 | AP000872.5 | 99.58% | pos 129855 (R+) | AP001533.4 | 98.94% | pos 28635 (F-) |
ABC10-45546100G5 | AP000872.5 | 98.11% | pos 45094 (F-) | |||
ABC10-45546800E3 | AP000872.5 | 97.64% | pos 101321 (R-) | AP000872.5 | 100% | pos 60203 (F+) |
ABC10-46305600M8 | AP001533.4 | 99.31% | pos 206115 (F+) | |||
ABC10-46307400D13 | AP000872.5 | 99.27% | pos 154124 (R+) | AP001533.4 | 100% | pos 53526 (F-) |
AP001533.4 | 99.27% | pos 11963 (R+) | ||||
ABC10-46312600E8 | AP001533.4 | 99.33% | pos 178027 (R-) | AP001533.4 | 100% | pos 136794 (F+) |
ABC10-46675400J14 | AP001533.4 | 99.87% | pos 154888 (R+) | AP001533.4 | 98.61% | pos 195791 (F-) |
ABC10-48935900P16 | AP001533.4 | 99.31% | pos 172230 (R+) | |||
ABC11-47091500J15 | AP000872.5 | 99.86% | pos 125156 (R+) | AP001533.4 | 98.96% | pos 20804 (F-) |
ABC11-47140200E19 | AP000872.5 | 99.63% | pos 136741 (R-) | AP000872.5 | 98.43% | pos 96973 (F+) |
ABC11-47149500H19 | AP000872.5 | 99.73% | pos 123102 (R-) | AP000872.5 | 98.4% | pos 81501 (F+) |
ABC11-47152100A16 | AP000872.5 | 99.86% | pos 87828 (R+) | AP000872.5 | 98.97% | pos 126852 (F-) |
ABC11-47166600F23 | AP000872.5 | 98.97% | pos 67187 (R-) | |||
ABC11-47188400I11 | AP001533.4 | 99.59% | pos 159038 (R-) | AP001533.4 | 99.35% | pos 121711 (F+) |
ABC11-47191000B13 | AP001533.4 | 99.58% | pos 196952 (R-) | AP001533.4 | 99.81% | pos 156800 (F+) |
ABC11-47192200G8 | AP001533.4 | 99.25% | pos 147564 (R+) | AP001533.4 | 99.52% | pos 190110 (F-) |
ABC11-47211100J19 | AP000872.5 | 99.73% | pos 18422 (R+) | AP000872.5 | 98.91% | pos 57610 (F-) |
ABC11-47224700G4 | AP001533.4 | 99.32% | pos 160872 (R+) | AP001533.4 | 99.19% | pos 201845 (F-) |
ABC11-47240800O12 | AP001533.4 | 99.23% | pos 85871 (R-) | AP001533.4 | 100% | pos 43790 (F+) |
ABC11-47242100I4 | AP001533.4 | 99.61% | pos 153513 (R+) | AP001533.4 | 99.33% | pos 194703 (F-) |
ABC11-47242900A14 | AP001533.4 | 99.47% | pos 204284 (R-) | AP001533.4 | 99.32% | pos 162736 (F+) |
ABC11-47243200G13 | AP001533.4 | 99.74% | pos 187883 (R-) | AP001533.4 | 98.41% | pos 146839 (F+) |
ABC11-47250700G23 | AP001533.4 | 99.33% | pos 167421 (F+) | |||
ABC11-47250700M4 | AP000872.5 | 99.04% | pos 62271 (R+) | AP000872.5 | 99.35% | pos 101125 (F-) |
ABC11-47252500I10 | AP001533.4 | 98.81% | pos 45380 (R-) | AP000872.5 | 99.57% | pos 146538 (F+) |
AP001533.4 | 99.09% | pos 45416 (R-) | AP001533.4 | 99.57% | pos 4377 (F+) | |
ABC11-47313400D9 | AP000872.5 | 100% | pos 36030 (R-) | |||
ABC11-47323000J4 | AP001533.4 | 99.15% | pos 72844 (R-) | AP001533.4 | 99.74% | pos 31998 (F+) |
ABC11-47323400H8 | AP000872.5 | 99.62% | pos 45770 (R+) | AP000872.5 | 99.61% | pos 85799 (F-) |
ABC11-47326500P14 | AP000872.5 | 99.87% | pos 135966 (R-) | AP000872.5 | 99.35% | pos 98243 (F+) |
ABC11-47380400E6 | AP001533.4 | 98.86% | pos 160908 (R+) | AP001533.4 | 99.07% | pos 201849 (F-) |
ABC11-47397100E22 | AP000872.5 | 99.32% | pos 150711 (R+) | AP001533.4 | 99.61% | pos 48817 (F-) |
AP001533.4 | 99.32% | pos 8550 (R+) | ||||
ABC11-47397400C14 | AP000872.5 | 98.36% | pos 12624 (F-) | |||
ABC11-47408600E1 | AP001533.4 | 99.35% | pos 155163 (R-) | AP001533.4 | 99.73% | pos 114888 (F+) |
ABC11-47408600K7 | AP000872.5 | 99.5% | pos 19714 (R+) | AP000872.5 | 99.61% | pos 61185 (F-) |
ABC11-47998300E21 | AP001533.4 | 97.67% | pos 85820 (R-) | AP001533.4 | 97.66% | pos 43838 (F+) |
ABC11-47999200I18 | AP001533.4 | 99.4% | pos 147575 (R+) | AP001533.4 | 99.14% | pos 190113 (F-) |
ABC11-48002500M1 | AP000872.5 | 99.87% | pos 136779 (R-) | AP000872.5 | 99.58% | pos 96926 (F+) |
ABC11-48004500N22 | AP000872.5 | 99.75% | pos 3803 (R-) | |||
ABC11-48007500H13 | AP000872.5 | 99.17% | pos 56288 (R-) | AP000872.5 | 98.97% | pos 18076 (F+) |
ABC11-48011300I11 | AP001533.4 | 98.72% | pos 114612 (R-) | AP001533.4 | 99.48% | pos 74259 (F+) |
ABC11-48011600E15 | AP001533.4 | 99.62% | pos 48826 (F-) | |||
ABC11-48015200P12 | AP000872.5 | 99.22% | pos 12617 (F-) | |||
ABC11-48016400H7 | AP001533.4 | 99.6% | pos 150735 (R-) | AP001533.4 | 99.59% | pos 111073 (F+) |
ABC11-48021100G3 | AP000872.5 | 99.24% | pos 40481 (R-) | AP000872.5 | 99.31% | pos 1141 (F+) |
ABC11-48022600F6 | AP000872.5 | 99.33% | pos 56819 (R-) | AP000872.5 | 99.71% | pos 14323 (F+) |
ABC11-48022900C21 | AP000872.5 | 98.6% | pos 143914 (R-) | AP000872.5 | 99.48% | pos 102461 (F+) |
AP001533.4 | 98.6% | pos 1753 (R-) | ||||
ABC11-48025900P10 | AP001533.4 | 99.87% | pos 58406 (R+) | AP001533.4 | 98.77% | pos 97475 (F-) |
ABC11-48030500F3 | AP001533.4 | 99.61% | pos 32586 (R+) | AP001533.4 | 99.47% | pos 73998 (F-) |
ABC11-48033300H8 | AP001533.4 | 98.97% | pos 197207 (R+) | |||
ABC11-48033600F12 | AP001533.4 | 99.83% | pos 184395 (R+) | |||
ABC11-48040000G8 | AP000872.5 | 99.67% | pos 27196 (R+) | AP000872.5 | 99.74% | pos 70932 (F-) |
ABC11-48045000B20 | AP000872.5 | 99.3% | pos 17867 (R+) | AP000872.5 | 99.64% | pos 57017 (F-) |
ABC11-48221900G2 | AP001533.4 | 99.81% | pos 59545 (R+) | AP001533.4 | 100% | pos 101563 (F-) |
ABC11-48222800J21 | AP000872.5 | 98.03% | pos 62309 (R+) | AP000872.5 | 98.56% | pos 101128 (F-) |
ABC11-48223300M3 | AP000872.5 | 99.53% | pos 11827 (R+) | AP000872.5 | 98.6% | pos 53632 (F-) |
ABC11-48223900I1 | AP001533.4 | 99.49% | pos 170666 (R+) | |||
ABC11-48224000A23 | AP000872.5 | 99.21% | pos 11826 (R+) | AP000872.5 | 98.46% | pos 53623 (F-) |
ABC11-48270100E2 | AP000872.5 | 99.41% | pos 29538 (F-) | |||
ABC11-48288900J14 | AP001533.4 | 98.39% | pos 143367 (R-) | AP001533.4 | 98.93% | pos 104848 (F+) |
ABC11-48297100L5 | AP001533.4 | 99.3% | pos 119244 (R+) | AP001533.4 | 99.29% | pos 161680 (F-) |
ABC11-48297700B8 | AP001533.4 | 98.81% | pos 88805 (R-) | AP001533.4 | 99.42% | pos 44523 (F+) |
ABC11-48322500H14 | AP000872.5 | 99.75% | pos 13702 (F-) | |||
ABC11-48322600K3 | AP000872.5 | 99.49% | pos 13703 (F-) | |||
ABC11-48323300L4 | AP001533.4 | 99.75% | pos 135159 (R+) | AP001533.4 | 99.73% | pos 174705 (F-) |
ABC11-48323300M6 | AP001533.4 | 98.13% | pos 135193 (R+) | AP001533.4 | 97.97% | pos 174706 (F-) |
ABC11-48335400F10 | AP001533.4 | 99.19% | pos 119258 (R+) | AP001533.4 | 99.87% | pos 161666 (F-) |
ABC11-48375900F8 | AP001533.4 | 99.09% | pos 30839 (R-) | AP000872.5 | 98.82% | pos 133037 (F+) |
ABC11-48400500B20 | AP000872.5 | 99.35% | pos 140743 (R+) | AP001533.4 | 99.6% | pos 40599 (F-) |
ABC11-48440500C15 | AP001533.4 | 99.29% | pos 153508 (R+) | AP001533.4 | 98.8% | pos 194725 (F-) |
ABC11-49323400E8 | AP000872.5 | 99.29% | pos 25681 (R-) | |||
ABC11-49323400H10 | AP001533.4 | 99.44% | pos 202743 (R+) | |||
ABC11-49337400C6 | AP001533.4 | 99.56% | pos 56493 (R-) | AP001533.4 | 98.99% | pos 15825 (F+) |
ABC11-49337400P3 | AP001533.4 | 99.42% | pos 29009 (R-) | AP000872.5 | 99.16% | pos 130563 (F+) |
ABC11-49338200J3 | AP001533.4 | 99.32% | pos 15279 (R-) | AP000872.5 | 99.43% | pos 115804 (F+) |
ABC11-49340900C9 | AP001533.4 | 98.97% | pos 170700 (R+) | |||
ABC11-49382900O22 | AP000872.5 | 99.06% | pos 97210 (R+) | AP000872.5 | 99.86% | pos 138190 (F-) |
ABC11-49385000A9 | AP000872.5 | 99.34% | pos 98387 (R-) | AP000872.5 | 99.84% | pos 57620 (F+) |
ABC11-49495800H2 | AP001533.4 | 100% | pos 25492 (R+) | AP001533.4 | 100% | pos 64776 (F-) |
ABC11-49496100I8 | AP001533.4 | 99.81% | pos 85569 (R-) | AP001533.4 | 99.46% | pos 45559 (F+) |
ABC11-49528200P18 | AP000872.5 | 98.18% | pos 143909 (R-) | AP000872.5 | 99.22% | pos 102466 (F+) |
AP001533.4 | 98.18% | pos 1748 (R-) | ||||
ABC11-49530300G24 | AP001533.4 | 98.55% | pos 156856 (R-) | AP001533.4 | 99.76% | pos 113781 (F+) |
ABC11-49540500N9 | AP001533.4 | 99.62% | pos 36219 (R-) | AP000872.5 | 98.91% | pos 139499 (F+) |
ABC11-49541200N10 | AP001533.4 | 98.22% | pos 190296 (F+) | |||
ABC11-49598000C16 | AP000872.5 | 99.09% | pos 135673 (R-) | AP000872.5 | 99.15% | pos 96981 (F+) |
ABC11-49601100C16 | AP001533.4 | 99.49% | pos 196895 (R+) | |||
ABC11-49603800L23 | AP000872.5 | 98.16% | pos 85434 (R+) | AP000872.5 | 98.75% | pos 126268 (F-) |
ABC11-49616300C7 | AP001533.4 | 99.84% | pos 58407 (R+) | AP001533.4 | 99.47% | pos 97483 (F-) |
ABC11-49639700O23 | AP001533.4 | 100% | pos 205851 (R-) | AP001533.4 | 98.13% | pos 163483 (F+) |
ABC11-49639900J22 | AP000872.5 | 99.01% | pos 48562 (R-) | AP000872.5 | 100% | pos 7344 (F+) |
ABC11-49698000K23 | AP001533.4 | 99.21% | pos 171955 (R-) | AP001533.4 | 99.59% | pos 133264 (F+) |
ABC12-46334100M2 | AP001533.4 | 100% | pos 55449 (R-) | AP001533.4 | 99.58% | pos 16280 (F+) |
ABC12-46337800K20 | AP000872.5 | 100% | pos 35937 (R-) | |||
ABC12-46356500M6 | AP000872.5 | 98.78% | pos 68288 (R+) | AP000872.5 | 98.31% | pos 109553 (F-) |
ABC12-46412200A12 | AP000872.5 | 99.23% | pos 100120 (R+) | AP000872.5 | 99.72% | pos 140789 (F-) |
ABC12-46658200L4 | AP001533.4 | 99.77% | pos 181477 (R+) | |||
ABC12-46668500H17 | AP001533.4 | 99.25% | pos 128895 (R-) | AP001533.4 | 99.87% | pos 88630 (F+) |
ABC12-46668600A2 | AP001533.4 | 99.49% | pos 196461 (F+) | |||
ABC12-46672700I3 | AP001533.4 | 100% | pos 53292 (R+) | AP001533.4 | 100% | pos 94308 (F-) |
ABC12-46726900L5 | AP000872.5 | 97.55% | pos 153891 (R+) | |||
AP001533.4 | 97.55% | pos 11730 (R+) | ||||
ABC12-46747600I15 | AP001533.4 | 99.86% | pos 27412 (R-) | AP000872.5 | 99.26% | pos 129277 (F+) |
ABC12-46795200K19 | AP000872.5 | 99.48% | pos 18965 (R+) | AP000872.5 | 99.08% | pos 57606 (F-) |
ABC12-46795700I19 | AP001533.4 | 99.55% | pos 133627 (R+) | AP001533.4 | 98.9% | pos 172320 (F-) |
ABC12-46796800O7 | AP000872.5 | 99.7% | pos 32380 (R-) | |||
ABC12-46835700L2 | AP000872.5 | 99.39% | pos 75389 (R-) | AP000872.5 | 100% | pos 34058 (F+) |
ABC12-46839900H12 | AP001533.4 | 99.06% | pos 187964 (R-) | AP001533.4 | 98.58% | pos 147776 (F+) |
ABC12-46841100N12 | AP001533.4 | 98.99% | pos 147735 (R-) | AP001533.4 | 99.42% | pos 108080 (F+) |
ABC12-46848900M19 | AP001533.4 | 98.94% | pos 167263 (R+) | |||
ABC12-46849400G22 | AP000872.5 | 98% | pos 115350 (R-) | AP000872.5 | 99.25% | pos 75740 (F+) |
ABC12-46853400K18 | AP000872.5 | 99.23% | pos 11219 (F-) | |||
ABC12-46861400F19 | AP001533.4 | 99.86% | pos 35492 (R-) | AP000872.5 | 99.2% | pos 138333 (F+) |
ABC12-46883100F23 | AP000872.5 | 98.73% | pos 65194 (R-) | |||
ABC12-46887800D20 | AP000872.5 | 98.34% | pos 35771 (R-) | |||
ABC12-46907200K16 | AP000872.5 | 99.67% | pos 51483 (R+) | AP000872.5 | 99.59% | pos 91290 (F-) |
ABC12-46924500F19 | AP000872.5 | 99.73% | pos 32373 (R-) | |||
ABC12-46925200D17 | AP001533.4 | 99.3% | pos 133919 (R-) | AP001533.4 | 99.3% | pos 92145 (F+) |
ABC12-46947500L19 | AP000872.5 | 98.84% | pos 28670 (R+) | AP000872.5 | 98.18% | pos 71899 (F-) |
ABC12-46947900G1 | AP000872.5 | 98.99% | pos 18216 (R+) | AP000872.5 | 100% | pos 58020 (F-) |
ABC12-46965300B11 | AP001533.4 | 98.28% | pos 32334 (R+) | AP001533.4 | 100% | pos 71684 (F-) |
ABC12-46965600D3 | AP001533.4 | 99.4% | pos 96123 (F-) | |||
ABC12-46967400I17 | AP001533.4 | 99.58% | pos 99841 (R-) | AP001533.4 | 99.86% | pos 61718 (F+) |
ABC12-46968300I21 | AP000872.5 | 98.68% | pos 91939 (R+) | AP000872.5 | 98.15% | pos 131655 (F-) |
ABC12-46970600O21 | AP000872.5 | 99.42% | pos 16717 (R-) | |||
ABC12-46972400M2 | AP000872.5 | 97.88% | pos 104388 (R+) | AP000872.5 | 97.84% | pos 144995 (F-) |
AP001533.4 | 97.84% | pos 2834 (F-) | ||||
ABC12-46977200C21 | AP001533.4 | 98.88% | pos 73206 (R+) | AP001533.4 | 99.01% | pos 113708 (F-) |
ABC12-46980200F22 | AP001533.4 | 98.62% | pos 16287 (F+) | |||
ABC12-46983500N9 | AP001533.4 | 99.61% | pos 15948 (R-) | AP000872.5 | 99.56% | pos 117987 (F+) |
ABC12-46987100H11 | AP001533.4 | 98.57% | pos 178559 (R-) | AP001533.4 | 99.71% | pos 139652 (F+) |
ABC12-46991700O17 | AP001533.4 | 99.17% | pos 120792 (R+) | AP001533.4 | 99.87% | pos 161002 (F-) |
ABC12-47003400H23 | AP000872.5 | 97.35% | pos 57670 (R-) | |||
ABC12-47010400H11 | AP000872.5 | 99.62% | pos 99933 (R-) | AP000872.5 | 98% | pos 59650 (F+) |
ABC12-47013200O15 | AP000872.5 | 99.47% | pos 100118 (R+) | AP000872.5 | 98.82% | pos 140782 (F-) |
ABC12-47014700J15 | AP001533.4 | 99.8% | pos 32277 (R+) | AP001533.4 | 99.63% | pos 71698 (F-) |
ABC12-47015000N5 | AP000872.5 | 99.59% | pos 116205 (R+) | AP000872.5 | 99.3% | pos 156178 (F-) |
AP001533.4 | 99.3% | pos 14017 (F-) | ||||
ABC12-47017400H10 | AP001533.4 | 99.35% | pos 76329 (R-) | AP001533.4 | 99.86% | pos 36052 (F+) |
ABC12-47032500I9 | AP001533.4 | 99.17% | pos 151660 (R+) | AP001533.4 | 99.36% | pos 191896 (F-) |
ABC12-47033100D18 | AP000872.5 | 98.84% | pos 99934 (R-) | AP000872.5 | 97.28% | pos 59637 (F+) |
ABC12-47039600K3 | AP000872.5 | 99.55% | pos 57788 (R-) | AP000872.5 | 100% | pos 19132 (F+) |
ABC12-47046400I22 | AP000872.5 | 99.33% | pos 87445 (R-) | AP000872.5 | 99.58% | pos 47415 (F+) |
ABC12-47839200A1 | AP000872.5 | 99.2% | pos 151221 (R+) | AP001533.4 | 99.6% | pos 48171 (F-) |
AP001533.4 | 99.2% | pos 9060 (R+) | ||||
ABC12-47956000K13 | AP000872.5 | 99.31% | pos 138040 (R-) | AP000872.5 | 99.23% | pos 97796 (F+) |
ABC12-47965100D7 | AP000872.5 | 99.36% | pos 41045 (F-) | |||
ABC12-47988800K14 | AP000872.5 | 99.46% | pos 86105 (R-) | AP000872.5 | 99.12% | pos 45743 (F+) |
ABC12-49022100O11 | AP000872.5 | 99.71% | pos 11227 (F-) | |||
ABC12-49022600E7 | AP000872.5 | 99.25% | pos 101533 (R+) | AP000872.5 | 99.49% | pos 142196 (F-) |
ABC12-49030600P15 | AP000872.5 | 99.37% | pos 116779 (R-) | AP000872.5 | 99.69% | pos 77191 (F+) |
ABC12-49030700M9 | AP000872.5 | 99.22% | pos 119771 (R-) | AP000872.5 | 99.46% | pos 80678 (F+) |
ABC12-49052100C5 | AP000872.5 | 98.47% | pos 83433 (R+) | AP000872.5 | 99.61% | pos 124408 (F-) |
ABC12-49054000D22 | AP000872.5 | 99.6% | pos 149663 (R+) | AP001533.4 | 99.1% | pos 46438 (F-) |
AP001533.4 | 99.6% | pos 7502 (R+) | ||||
ABC12-49054800O23 | AP000872.5 | 99.29% | pos 31516 (F-) | |||
ABC12-49061100D23 | AP001533.4 | 99.44% | pos 20568 (R-) | AP000872.5 | 99.34% | pos 123118 (F+) |
ABC12-49071900F17 | AP001533.4 | 99.57% | pos 110114 (R+) | AP001533.4 | 99.31% | pos 150752 (F-) |
ABC12-49095800L20 | AP000872.5 | 99.37% | pos 105185 (R+) | AP000872.5 | 99.63% | pos 143731 (F-) |
AP001533.4 | 99.63% | pos 1570 (F-) | ||||
ABC12-49095900B21 | AP001533.4 | 99.46% | pos 177323 (F+) | |||
ABC12-49097900G23 | AP000872.5 | 99.86% | pos 85361 (R-) | AP000872.5 | 99.72% | pos 45525 (F+) |
ABC12-49114200K23 | AP000872.5 | 99.04% | pos 90369 (R-) | |||
ABC12-49116300G24 | AP001533.4 | 98.78% | pos 194768 (F+) | |||
ABC12-49116400D14 | AP000872.5 | 98.93% | pos 105799 (R-) | AP000872.5 | 98.93% | pos 64255 (F+) |
ABC12-49138300M12 | AP000872.5 | 99.61% | pos 13795 (R+) | AP000872.5 | 99.09% | pos 52151 (F-) |
ABC12-49138400G22 | AP001533.4 | 99.86% | pos 20571 (R-) | AP000872.5 | 99.59% | pos 123128 (F+) |
ABC12-49172100E16 | AP000872.5 | 98.67% | pos 52592 (R-) | AP000872.5 | 100% | pos 12968 (F+) |
ABC12-49198900L3 | AP001533.4 | 99.73% | pos 161663 (R+) | AP001533.4 | 99.74% | pos 201616 (F-) |
ABC12-49203300C12 | AP001533.4 | 100% | pos 33742 (R+) | AP001533.4 | 99.6% | pos 73232 (F-) |
ABC12-49210100M14 | AP000872.5 | 99.76% | pos 86472 (R-) | AP000872.5 | 99.61% | pos 48098 (F+) |
ABC12-49213900M1 | AP000872.5 | 99.58% | pos 94749 (R-) | AP000872.5 | 99.37% | pos 55665 (F+) |
ABC12-49217900G4 | AP001533.4 | 99.12% | pos 53307 (R+) | AP001533.4 | 100% | pos 94308 (F-) |
ABC12-49218900M5 | AP000872.5 | 99.45% | pos 64310 (R-) | AP000872.5 | 99.24% | pos 23974 (F+) |
ABC12-49219900B16 | AP001533.4 | 99.38% | pos 161670 (R+) | AP001533.4 | 99.56% | pos 201616 (F-) |
ABC12-49226200G5 | AP000872.5 | 99.15% | pos 125401 (R-) | AP000872.5 | 99.73% | pos 86038 (F+) |
ABC12-49227800F11 | AP001533.4 | 99.45% | pos 174796 (R-) | AP001533.4 | 99.52% | pos 137426 (F+) |
ABC12-49230300F20 | AP000872.5 | 99.17% | pos 50220 (R-) | AP000872.5 | 100% | pos 9978 (F+) |
ABC12-49243600K23 | AP001533.4 | 100% | pos 174776 (R-) | AP001533.4 | 100% | pos 137434 (F+) |
ABC12-49283200I11 | AP001533.4 | 99.6% | pos 30955 (R+) | AP001533.4 | 99.33% | pos 72379 (F-) |
ABC12-7903949H5 | AP001533.4 | 99.21% | pos 76327 (R-) | AP001533.4 | 100% | pos 36052 (F+) |
ABC12-7919749F17 | AP000872.5 | 99.37% | pos 57770 (R-) | AP000872.5 | 99.31% | pos 19161 (F+) |
ABC12-7920949C19 | AP001533.4 | 100% | pos 16549 (R-) | AP000872.5 | 99.75% | pos 119177 (F+) |
ABC13-1008022G10 | AP001533.4 | 99.62% | pos 96213 (R-) | AP001533.4 | 99.37% | pos 56018 (F+) |
ABC13-1008022I19 | AP001533.4 | 99.47% | pos 134765 (R+) | AP001533.4 | 99.74% | pos 170781 (F-) |
ABC13-1016422G21 | AP001533.4 | 99.69% | pos 114607 (R-) | AP001533.4 | 99.49% | pos 78652 (F+) |
ABC13-1017022G1 | AP000872.5 | 98.59% | pos 76000 (R+) | AP000872.5 | 99.87% | pos 114554 (F-) |
ABC13-1023622B5 | AP001533.4 | 99.14% | pos 114591 (R-) | AP001533.4 | 99.58% | pos 78653 (F+) |
ABC13-1854170E7 | AP001533.4 | 99.6% | pos 149590 (R-) | AP001533.4 | 99.48% | pos 111047 (F+) |
ABC13-47475400D13 | AP000872.5 | 99.32% | pos 92496 (R+) | AP000872.5 | 99.44% | pos 132070 (F-) |
ABC13-47479000I15 | AP000872.5 | 98.32% | pos 78402 (R+) | AP000872.5 | 99.74% | pos 118274 (F-) |
ABC13-47484200J24 | AP001533.4 | 99.11% | pos 97697 (R+) | AP001533.4 | 100% | pos 138610 (F-) |
ABC13-47485200C8 | AP001533.4 | 99.27% | pos 66661 (R-) | AP001533.4 | 98.2% | pos 27780 (F+) |
ABC13-47489500D10 | AP001533.4 | 100% | pos 114463 (R+) | AP001533.4 | 99.75% | pos 153530 (F-) |
ABC13-47493000A13 | AP001533.4 | 99.35% | pos 140757 (R+) | AP001533.4 | 100% | pos 181169 (F-) |
ABC13-47545300N21 | AP001533.4 | 99.37% | pos 134858 (R-) | AP001533.4 | 99.72% | pos 96251 (F+) |
ABC13-47619200I6 | AP001533.4 | 99.24% | pos 121685 (R+) | AP001533.4 | 99.87% | pos 156573 (F-) |
ABC13-47627600A11 | AP001533.4 | 99.61% | pos 130007 (R+) | AP001533.4 | 99.12% | pos 168107 (F-) |
ABC13-47628400D10 | AP001533.4 | 99.87% | pos 127317 (F-) | |||
ABC13-47643600I9 | AP001533.4 | 99.74% | pos 158431 (R-) | AP001533.4 | 99.58% | pos 119004 (F+) |
ABC13-47644000A4 | AP001533.4 | 99.61% | pos 197387 (R+) | |||
ABC13-47659200C15 | AP001533.4 | 99.82% | pos 186151 (R+) | |||
ABC13-47671900J22 | AP000872.5 | 99.5% | pos 14788 (F-) | |||
ABC13-47671900L20 | AP001533.4 | 98.84% | pos 121698 (R+) | |||
ABC13-47671900O7 | AP000872.5 | 98.12% | pos 128225 (R-) | AP000872.5 | 99.23% | pos 85748 (F+) |
ABC13-47675500E7 | AP000872.5 | 98.86% | pos 76044 (R+) | AP000872.5 | 99.57% | pos 115398 (F-) |
ABC13-48047300I7 | AP000872.5 | 99.5% | pos 47669 (R-) | AP000872.5 | 99.74% | pos 7668 (F+) |
ABC13-48052200I18 | AP001533.4 | 99.09% | pos 87325 (R+) | AP001533.4 | 99.63% | pos 128268 (F-) |
ABC13-48052900J24 | AP001533.4 | 99.55% | pos 39354 (R+) | AP001533.4 | 99.8% | pos 77676 (F-) |
ABC13-48064600I3 | AP001533.4 | 99.86% | pos 199885 (R-) | AP001533.4 | 99.32% | pos 160108 (F+) |
ABC13-48065400E19 | AP001533.4 | 99.6% | pos 73045 (R+) | AP001533.4 | 99.32% | pos 112979 (F-) |
ABC13-48551800P22 | AP000872.5 | 99.84% | pos 43096 (R-) | AP000872.5 | 99.72% | pos 6808 (F+) |
ABC13-48552300E1 | AP001533.4 | 100% | pos 115129 (R+) | AP001533.4 | 99.72% | pos 153924 (F-) |
ABC13-48558700P11 | AP001533.4 | 99.74% | pos 73021 (R+) | AP001533.4 | 99.49% | pos 112973 (F-) |
ABC13-48559100I23 | AP000872.5 | 99.6% | pos 103989 (R-) | AP000872.5 | 99.08% | pos 63203 (F+) |
ABC13-48559900F9 | AP001533.4 | 100% | pos 15286 (R+) | AP001533.4 | 99.29% | pos 55029 (F-) |
ABC13-48562700A13 | AP000872.5 | 99.63% | pos 17966 (F-) | |||
ABC13-48563000D24 | AP001533.4 | 99.57% | pos 66688 (R-) | AP001533.4 | 98.67% | pos 27772 (F+) |
ABC13-48575000H12 | AP001533.4 | 99.75% | pos 199946 (F+) | |||
ABC13-48575500P4 | AP001533.4 | 99.86% | pos 41564 (R-) | AP000872.5 | 99.74% | pos 141745 (F+) |
ABC13-48588600E11 | AP000872.5 | 98.41% | pos 84031 (R-) | AP000872.5 | 99.04% | pos 42738 (F+) |
ABC13-48594800K1 | AP001533.4 | 99.87% | pos 114455 (R+) | AP001533.4 | 99.38% | pos 153535 (F-) |
ABC13-48607600G12 | AP001533.4 | 98.59% | pos 49857 (R-) | AP000872.5 | 99.68% | pos 153754 (F+) |
AP001533.4 | 99.68% | pos 11593 (F+) | ||||
ABC13-48644900P20 | AP001533.4 | 100% | pos 121433 (R+) | |||
ABC13-48698800O17 | AP001533.4 | 99.53% | pos 22981 (R+) | AP001533.4 | 99.1% | pos 63125 (F-) |
ABC13-48706800A21 | AP001533.4 | 99.36% | pos 177896 (R+) | |||
ABC13-48707700I18 | AP001533.4 | 99.61% | pos 138710 (R-) | AP001533.4 | 98.59% | pos 99054 (F+) |
ABC13-48717000N7 | AP000872.5 | 99.83% | pos 122756 (R+) | AP001533.4 | 99.8% | pos 19581 (F-) |
ABC13-48727400I16 | AP001533.4 | 98.79% | pos 172969 (F+) | |||
ABC13-48729800I7 | AP001533.4 | 98.97% | pos 65574 (R+) | AP001533.4 | 99.06% | pos 104521 (F-) |
ABC13-48745300F22 | AP000872.5 | 99.86% | pos 90462 (R-) | AP000872.5 | 99.43% | pos 53019 (F+) |
ABC13-48817700L2 | AP000872.5 | 99.87% | pos 36303 (R-) | |||
ABC13-48824200A21 | AP001533.4 | 99.67% | pos 149564 (R-) | AP001533.4 | 97.71% | pos 112200 (F+) |
ABC13-48825700O9 | AP001533.4 | 100% | pos 149553 (R-) | AP001533.4 | 99.6% | pos 111918 (F+) |
ABC13-48830300I18 | AP001533.4 | 99.87% | pos 197371 (R+) | |||
ABC13-48832200N14 | AP001533.4 | 99.73% | pos 122038 (R-) | AP001533.4 | 99.87% | pos 81715 (F+) |
ABC13-48834500I16 | AP000872.5 | 98.98% | pos 76044 (R+) | AP000872.5 | 98.97% | pos 115456 (F-) |
ABC13-48835100M11 | AP000872.5 | 99.08% | pos 55304 (R-) | AP000872.5 | 100% | pos 14361 (F+) |
ABC13-48839700D1 | AP001533.4 | 99.02% | pos 151195 (R-) | AP001533.4 | 99.87% | pos 114177 (F+) |
ABC13-48842100M10 | AP001533.4 | 99.12% | pos 90417 (R-) | AP001533.4 | 99.09% | pos 51789 (F+) |
ABC13-48842200F14 | AP000872.5 | 99.07% | pos 30255 (R+) | AP000872.5 | 99.49% | pos 69587 (F-) |
ABC13-48854800N17 | AP000872.5 | 99.75% | pos 55284 (R-) | AP000872.5 | 98.29% | pos 14392 (F+) |
ABC13-48857500I10 | AP000872.5 | 99.71% | pos 34441 (R-) | |||
ABC13-48873000N21 | AP000872.5 | 98.96% | pos 151317 (R-) | AP000872.5 | 99.74% | pos 113818 (F+) |
AP001533.4 | 98.96% | pos 9156 (R-) | ||||
ABC13-48875700I19 | AP001533.4 | 99.73% | pos 175412 (F+) | |||
ABC13-48876800P12 | AP001533.4 | 99.72% | pos 47363 (R-) | AP000872.5 | 99.51% | pos 147573 (F+) |
AP001533.4 | 99.51% | pos 5412 (F+) | ||||
ABC13-48887200G5 | AP000872.5 | 100% | pos 118858 (R-) | AP000872.5 | 98.7% | pos 77425 (F+) |
ABC13-48902900J18 | AP001533.4 | 99.73% | pos 183979 (R-) | AP001533.4 | 99.6% | pos 144249 (F+) |
ABC13-48903800N17 | AP001533.4 | 99.2% | pos 183993 (R-) | AP001533.4 | 99.87% | pos 144249 (F+) |
ABC13-48904400L18 | AP001533.4 | 99.57% | pos 164802 (R+) | AP001533.4 | 99.57% | pos 204240 (F-) |
ABC13-48905300E16 | AP001533.4 | 99.87% | pos 183995 (R-) | AP001533.4 | 99.86% | pos 144258 (F+) |
ABC13-48905300L13 | AP001533.4 | 99.86% | pos 184002 (R-) | AP001533.4 | 99.29% | pos 144304 (F+) |
ABC13-48906500M3 | AP000872.5 | 100% | pos 49771 (R-) | AP000872.5 | 100% | pos 11432 (F+) |
ABC13-49695600G16 | AP001533.4 | 99.39% | pos 206426 (R-) | AP001533.4 | 100% | pos 166705 (F+) |
ABC13-49699400G8 | AP001533.4 | 99.71% | pos 121080 (R-) | AP001533.4 | 100% | pos 84534 (F+) |
ABC13-49701100C20 | AP000872.5 | 99.49% | pos 144411 (R-) | AP000872.5 | 99.35% | pos 105453 (F+) |
AP001533.4 | 99.49% | pos 2250 (R-) | ||||
ABC13-49711500I22 | AP001533.4 | 99.44% | pos 51683 (R+) | AP001533.4 | 99.12% | pos 91591 (F-) |
ABC13-49738200C20 | AP000872.5 | 100% | pos 144399 (R-) | AP000872.5 | 100% | pos 106080 (F+) |
AP001533.4 | 100% | pos 2238 (R-) | ||||
ABC13-49738800N21 | AP001533.4 | 99.84% | pos 206425 (R-) | AP001533.4 | 99.49% | pos 166716 (F+) |
ABC13-49739300I1 | AP001533.4 | 99.87% | pos 123642 (R+) | AP001533.4 | 99.35% | pos 161294 (F-) |
ABC13-49743000N20 | AP001533.4 | 99.18% | pos 87325 (R+) | AP001533.4 | 99.86% | pos 128270 (F-) |
ABC13-49749400C13 | AP000872.5 | 99.48% | pos 20218 (R-) | |||
ABC13-49749500F9 | AP000872.5 | 98.98% | pos 20229 (R-) | |||
ABC13-49752800F13 | AP000872.5 | 99.65% | pos 93820 (R-) | AP000872.5 | 98.74% | pos 55175 (F+) |
ABC13-49754400M20 | AP000872.5 | 99.7% | pos 47656 (R-) | AP000872.5 | 99.86% | pos 7664 (F+) |
ABC13-49754600M9 | AP001533.4 | 98.71% | pos 87441 (R-) | AP001533.4 | 99.17% | pos 48659 (F+) |
ABC13-49766700N7 | AP000872.5 | 98.62% | pos 39589 (R-) | |||
ABC13-908122O9 | AP000872.5 | 99.34% | pos 27390 (R-) | |||
ABC13-908222C20 | AP000872.5 | 100% | pos 49781 (R-) | AP000872.5 | 100% | pos 11409 (F+) |
ABC13-909022M6 | AP001533.4 | 100% | pos 190693 (F+) | |||
ABC13-926422A6 | AP001533.4 | 99.35% | pos 65908 (R+) | AP001533.4 | 99.75% | pos 105926 (F-) |
ABC13-926722B20 | AP001533.4 | 99.01% | pos 164780 (R+) | AP001533.4 | 99.74% | pos 204273 (F-) |
ABC13-927322N6 | AP000872.5 | 100% | pos 9322 (R+) | AP000872.5 | 99.7% | pos 49533 (F-) |
ABC13-940822E19 | AP001533.4 | 99.52% | pos 190673 (F+) | |||
ABC13-945422C18 | AP001533.4 | 98.47% | pos 46960 (F-) | |||
ABC13-946822I23 | AP001533.4 | 99.22% | pos 83999 (R-) | AP001533.4 | 99.71% | pos 44474 (F+) |
ABC14-1017014M2 | AP000872.5 | 99.86% | pos 49549 (R+) | AP000872.5 | 100% | pos 89815 (F-) |
ABC14-1051414B15 | AP000872.5 | 100% | pos 152193 (R+) | AP001533.4 | 100% | pos 49105 (F-) |
AP001533.4 | 100% | pos 10032 (R+) | ||||
ABC14-1054922C23 | AP001533.4 | 100% | pos 43589 (R+) | |||
ABC14-1054922H24 | AP001533.4 | 99.13% | pos 49368 (R+) | AP001533.4 | 99.4% | pos 92223 (F-) |
ABC14-1054922J15 | AP001533.4 | 99.74% | pos 49369 (R+) | |||
ABC14-1064814L8 | AP001533.4 | 99.74% | pos 91335 (R+) | AP001533.4 | 99.71% | pos 130635 (F-) |
ABC14-1065114P2 | AP000872.5 | 98.73% | pos 104179 (R-) | AP000872.5 | 97.39% | pos 64510 (F+) |
ABC14-1065814L1 | AP001533.4 | 100% | pos 198216 (F+) | |||
ABC14-1078122D1 | AP001533.4 | 98.87% | pos 151444 (R-) | AP001533.4 | 100% | pos 108085 (F+) |
ABC14-1081422A14 | AP001533.4 | 99.75% | pos 49376 (R+) | AP001533.4 | 99.15% | pos 92212 (F-) |
ABC14-1110822L18 | AP000872.5 | 99.35% | pos 81723 (R-) | AP000872.5 | 99.49% | pos 40390 (F+) |
ABC14-1142122N15 | AP000872.5 | 99.15% | pos 147582 (R+) | AP001533.4 | 99.86% | pos 49262 (F-) |
AP001533.4 | 99.15% | pos 5421 (R+) | ||||
ABC14-1143322M3 | AP001533.4 | 99.73% | pos 168342 (R-) | AP001533.4 | 99.76% | pos 125314 (F+) |
ABC14-1143522F8 | AP000872.5 | 99.14% | pos 19227 (R+) | AP000872.5 | 99.11% | pos 63465 (F-) |
ABC14-1144322I7 | AP001533.4 | 99.5% | pos 167088 (R-) | AP001533.4 | 99.44% | pos 123977 (F+) |
ABC14-1185522D24 | AP001533.4 | 100% | pos 25989 (R+) | AP001533.4 | 98.9% | pos 69042 (F-) |
ABC14-1190022F22 | AP001533.4 | 100% | pos 48403 (R-) | AP000872.5 | 99.84% | pos 147672 (F+) |
AP001533.4 | 99.84% | pos 5511 (F+) | ||||
ABC14-50076800H14 | AP000872.5 | 99.46% | pos 156554 (R-) | AP000872.5 | 99.72% | pos 119547 (F+) |
AP001533.4 | 99.46% | pos 14393 (R-) | ||||
ABC14-50078300L4 | AP000872.5 | 99.34% | pos 31286 (R-) | |||
ABC14-50079800E16 | AP001533.4 | 99.85% | pos 138583 (R+) | AP001533.4 | 99.85% | pos 176976 (F-) |
ABC14-50101700C4 | AP000872.5 | 100% | pos 152845 (R-) | AP000872.5 | 99.83% | pos 113253 (F+) |
AP001533.4 | 100% | pos 10684 (R-) | ||||
ABC14-50102700F2 | AP000872.5 | 100% | pos 147019 (R-) | AP000872.5 | 100% | pos 105872 (F+) |
AP001533.4 | 100% | pos 4858 (R-) | ||||
ABC14-50108400G3 | AP001533.4 | 100% | pos 147666 (R+) | AP001533.4 | 99.05% | pos 185944 (F-) |
ABC14-50113000L3 | AP000872.5 | 99.84% | pos 43097 (R+) | AP000872.5 | 99.15% | pos 82881 (F-) |
ABC14-50114500H16 | AP000872.5 | 99.85% | pos 61873 (R+) | AP000872.5 | 99.73% | pos 101476 (F-) |
ABC14-50118200J24 | AP001533.4 | 99.72% | pos 62375 (R+) | AP001533.4 | 99.18% | pos 104273 (F-) |
ABC14-50120600D4 | AP000872.5 | 100% | pos 109029 (R+) | AP000872.5 | 99.84% | pos 148483 (F-) |
AP001533.4 | 99.84% | pos 6322 (F-) | ||||
ABC14-50122000G8 | AP001533.4 | 99.85% | pos 205112 (R+) | |||
ABC14-50122500D20 | AP000872.5 | 99.36% | pos 106534 (R+) | AP000872.5 | 99.84% | pos 146851 (F-) |
AP001533.4 | 99.84% | pos 4690 (F-) | ||||
ABC14-50124500C2 | AP001533.4 | 100% | pos 113032 (R-) | AP001533.4 | 99.16% | pos 74996 (F+) |
ABC14-50125600A4 | AP001533.4 | 99.09% | pos 104545 (R-) | AP001533.4 | 99.85% | pos 64717 (F+) |
ABC14-50128700A8 | AP001533.4 | 99.52% | pos 169611 (R+) | |||
ABC14-50129500H15 | AP000872.5 | 99.86% | pos 11876 (R-) | |||
ABC14-50129700N11 | AP000872.5 | 99.86% | pos 38162 (R-) | |||
ABC14-50132700D8 | AP001533.4 | 99.85% | pos 189870 (F+) | |||
ABC14-50134400I12 | AP001533.4 | 99.74% | pos 206775 (R-) | AP001533.4 | 99.86% | pos 167120 (F+) |
ABC14-50140600L2 | AP001533.4 | 99.85% | pos 79374 (R-) | AP001533.4 | 99.85% | pos 41161 (F+) |
ABC14-50147200O19 | AP001533.4 | 99.66% | pos 147686 (R+) | AP001533.4 | 99.17% | pos 185943 (F-) |
ABC14-50147600M19 | AP000872.5 | 98.55% | pos 156545 (R-) | AP000872.5 | 99.84% | pos 119553 (F+) |
AP001533.4 | 98.55% | pos 14384 (R-) | ||||
ABC14-50150900I3 | AP001533.4 | 99.86% | pos 73552 (R+) | AP001533.4 | 100% | pos 113649 (F-) |
ABC14-50155800O17 | AP000872.5 | 98.91% | pos 78093 (R+) | AP000872.5 | 97.97% | pos 118584 (F-) |
ABC14-50156500D8 | AP001533.4 | 100% | pos 33567 (R-) | AP000872.5 | 99.84% | pos 134668 (F+) |
ABC14-50162500A20 | AP000872.5 | 99.72% | pos 33302 (F-) | |||
ABC14-50163400F18 | AP001533.4 | 99.5% | pos 163138 (R-) | AP001533.4 | 100% | pos 124108 (F+) |
ABC14-50165800A22 | AP001533.4 | 100% | pos 63060 (R+) | AP001533.4 | 99.73% | pos 102351 (F-) |
ABC14-50171200A23 | AP000872.5 | 99.87% | pos 51616 (R-) | AP000872.5 | 99.85% | pos 11184 (F+) |
ABC14-50172500O9 | AP000872.5 | 100% | pos 51612 (R-) | AP000872.5 | 99.84% | pos 11182 (F+) |
ABC14-50175000E1 | AP000872.5 | 97.7% | pos 129347 (R-) | AP000872.5 | 99.34% | pos 87965 (F+) |
ABC14-50176000L20 | AP001533.4 | 99.86% | pos 46682 (R+) | AP001533.4 | 99.84% | pos 86062 (F-) |
ABC14-50179400N16 | AP000872.5 | 99.42% | pos 99478 (R+) | AP000872.5 | 98.92% | pos 141201 (F-) |
ABC14-50185300N23 | AP000872.5 | 99.86% | pos 52543 (R+) | AP000872.5 | 100% | pos 90153 (F-) |
ABC14-50186800H16 | AP001533.4 | 99.84% | pos 52467 (R+) | AP001533.4 | 99.56% | pos 90031 (F-) |
ABC14-50189000N8 | AP000872.5 | 100% | pos 99456 (R+) | AP000872.5 | 100% | pos 141208 (F-) |
ABC14-50191700N14 | AP000872.5 | 99.47% | pos 69844 (R-) | AP000872.5 | 99.23% | pos 31112 (F+) |
ABC14-50193000C23 | AP001533.4 | 99.85% | pos 164941 (R-) | AP001533.4 | 99.46% | pos 126803 (F+) |
ABC14-50198300M21 | AP001533.4 | 99.55% | pos 82882 (R+) | AP001533.4 | 99.86% | pos 121091 (F-) |
ABC14-50202100N4 | AP000872.5 | 99.28% | pos 51983 (R-) | |||
ABC14-50211300H4 | AP001533.4 | 99.26% | pos 36950 (R+) | AP001533.4 | 99.41% | pos 73828 (F-) |
ABC14-50212100O8 | AP000872.5 | 99.73% | pos 103033 (R+) | AP000872.5 | 100% | pos 142472 (F-) |
ABC14-50405300M14 | AP001533.4 | 100% | pos 81788 (R-) | AP001533.4 | 99.83% | pos 40705 (F+) |
ABC14-50405500J22 | AP001533.4 | 99.86% | pos 196878 (F+) | |||
ABC14-50406300E1 | AP001533.4 | 99.58% | pos 66717 (R-) | AP001533.4 | 99.86% | pos 27054 (F+) |
ABC14-50408600A15 | AP000872.5 | 99.61% | pos 24998 (R-) | |||
ABC14-50409300A18 | AP000872.5 | 99.08% | pos 24999 (R-) | |||
ABC14-50413200I3 | AP001533.4 | 99.86% | pos 200564 (R+) | |||
ABC14-50414100C1 | AP001533.4 | 97.71% | pos 91843 (R+) | AP001533.4 | 100% | pos 133244 (F-) |
ABC14-50417300L15 | AP001533.4 | 99.53% | pos 136166 (R-) | AP001533.4 | 99.69% | pos 95910 (F+) |
ABC14-50418200I15 | AP001533.4 | 99.13% | pos 201763 (F+) | |||
ABC14-50419300M21 | AP001533.4 | 99.16% | pos 201769 (F+) | |||
ABC14-50461400A4 | AP001533.4 | 100% | pos 164881 (R-) | AP001533.4 | 99.71% | pos 124402 (F+) |
ABC14-50467500H2 | AP001533.4 | 99.84% | pos 182418 (R+) | |||
ABC14-50469400A24 | AP001533.4 | 99.65% | pos 182421 (R+) | |||
ABC14-50926800O13 | AP001533.4 | 100% | pos 147666 (R+) | AP001533.4 | 99% | pos 185972 (F-) |
ABC14-50927300K13 | AP000872.5 | 99.45% | pos 104394 (R-) | AP000872.5 | 99.42% | pos 64056 (F+) |
ABC14-50929200L24 | AP000872.5 | 99.85% | pos 140763 (R+) | AP001533.4 | 99.66% | pos 34694 (F-) |
ABC14-50930600I22 | AP001533.4 | 99.52% | pos 184445 (F+) | |||
ABC14-50932700H2 | AP001533.4 | 99.86% | pos 184420 (R+) | |||
ABC14-50965300D18 | AP001533.4 | 99.68% | pos 91349 (R+) | AP001533.4 | 99.74% | pos 130635 (F-) |
ABC14-50967200A17 | AP001533.4 | 100% | pos 113511 (R-) | AP001533.4 | 99.74% | pos 74572 (F+) |
ABC14-50973300M8 | AP000872.5 | 100% | pos 147017 (R-) | AP000872.5 | 100% | pos 105864 (F+) |
AP001533.4 | 100% | pos 4856 (R-) | ||||
ABC14-50977000H11 | AP001533.4 | 99.74% | pos 23436 (R+) | AP001533.4 | 100% | pos 64176 (F-) |
ABC14-50995300O1 | AP000872.5 | 99.69% | pos 43099 (R+) | AP000872.5 | 99.04% | pos 82881 (F-) |
ABC14-50997200O21 | AP001533.4 | 100% | pos 161278 (R+) | AP001533.4 | 99.85% | pos 201263 (F-) |
ABC14-50997400P11 | AP001533.4 | 99.85% | pos 80258 (R+) | AP001533.4 | 99.83% | pos 119678 (F-) |
ABC14-51451000H21 | AP000872.5 | 100% | pos 101474 (R-) | |||
ABC14-8071949H1 | AP000872.5 | 99.34% | pos 31299 (R-) | |||
ABC14-950014M8 | AP000872.5 | 99.86% | pos 11865 (R-) | |||
ABC14-954214I19 | AP001533.4 | 99.19% | pos 104525 (R-) | AP001533.4 | 99.86% | pos 64717 (F+) |
ABC14-954514O3 | AP001533.4 | 99.86% | pos 182773 (R+) | |||
ABC14-973714D6 | AP000872.5 | 99.71% | pos 32765 (R+) | AP000872.5 | 99.24% | pos 73461 (F-) |
ABC14-974514I18 | AP000872.5 | 99.85% | pos 140764 (R+) | AP001533.4 | 99.67% | pos 34694 (F-) |
ABC7-40177900E10 | AP000872.5 | 99.85% | pos 107037 (R-) | AP000872.5 | 99.23% | pos 65689 (F+) |
ABC7-40254500O13 | AP000872.5 | 100% | pos 122187 (R-) | AP000872.5 | 99.62% | pos 85501 (F+) |
ABC7-40256200L10 | AP001533.4 | 99.66% | pos 123270 (R-) | AP001533.4 | 99.41% | pos 89428 (F+) |
ABC7-40272100C14 | AP000872.5 | 99.21% | pos 102902 (R+) | AP000872.5 | 100% | pos 135329 (F-) |
ABC7-40273400J16 | AP000872.5 | 100% | pos 32076 (F+) | |||
ABC7-40280000M11 | AP000872.5 | 97.78% | pos 76758 (R+) | AP000872.5 | 99.67% | pos 119402 (F-) |
ABC7-40281600O11 | AP001533.4 | 99.81% | pos 126759 (F-) | |||
ABC7-40288400D12 | AP001533.4 | 100% | pos 124342 (R+) | AP001533.4 | 99.54% | pos 160004 (F-) |
ABC7-40619200L23 | AP000872.5 | 100% | pos 146284 (R+) | AP001533.4 | 99.23% | pos 43317 (F-) |
AP001533.4 | 100% | pos 4123 (R+) | ||||
ABC7-40622100O13 | AP001533.4 | 98.63% | pos 201105 (R+) | |||
ABC7-40623700G18 | AP001533.4 | 99.88% | pos 60826 (R+) | AP001533.4 | 99.86% | pos 97700 (F-) |
ABC7-40627700H10 | AP001533.4 | 99.62% | pos 93052 (R-) | AP001533.4 | 99.72% | pos 59152 (F+) |
ABC7-40642200G23 | AP001533.4 | 99.54% | pos 170328 (R-) | AP001533.4 | 99.77% | pos 125962 (F+) |
ABC7-41852100P21 | AP001533.4 | 100% | pos 138060 (R+) | AP001533.4 | 99.55% | pos 175983 (F-) |
ABC7-41852200B17 | AP001533.4 | 99.84% | pos 140772 (R-) | AP001533.4 | 99.35% | pos 104054 (F+) |
ABC7-42052100D3 | AP000872.5 | 100% | pos 25637 (R+) | AP000872.5 | 99.15% | pos 63852 (F-) |
ABC7-42052300E23 | AP001533.4 | 99.31% | pos 72597 (R-) | AP001533.4 | 99.17% | pos 38811 (F+) |
ABC7-42055800J3 | AP000872.5 | 99.72% | pos 95742 (R+) | AP000872.5 | 99.85% | pos 129530 (F-) |
ABC7-42057100K9 | AP000872.5 | 99.74% | pos 504 (R+) | AP000872.5 | 99.75% | pos 40577 (F-) |
ABC7-42362100C1 | AP001533.4 | 98.33% | pos 206675 (F+) | |||
ABC7-42372300L21 | AP001533.4 | 99.68% | pos 203223 (R+) | |||
ABC7-42373400E11 | AP001533.4 | 99.45% | pos 169810 (R+) | |||
ABC7-42382900G21 | AP001533.4 | 100% | pos 181024 (R-) | |||
ABC7-42387500G18 | AP001533.4 | 99.26% | pos 25353 (R+) | AP001533.4 | 99.64% | pos 67310 (F-) |
ABC7-42389600E5 | AP001533.4 | 99.62% | pos 30244 (R-) | AP000872.5 | 99.29% | pos 129405 (F+) |
ABC7-42389700O11 | AP001533.4 | 99.85% | pos 203565 (F+) | |||
ABC7-42391500J7 | AP001533.4 | 100% | pos 144343 (R+) | AP001533.4 | 99.48% | pos 186019 (F-) |
ABC7-42392500J11 | AP001533.4 | 98.97% | pos 158629 (R+) | |||
ABC7-42394200E18 | AP000872.5 | 99.61% | pos 64864 (R+) | |||
ABC7-42395000I16 | AP000872.5 | 99.7% | pos 43867 (R-) | AP000872.5 | 99.24% | pos 6987 (F+) |
ABC7-42395600B9 | AP001533.4 | 99.25% | pos 76450 (R+) | |||
ABC7-42396700K7 | AP000872.5 | 100% | pos 13776 (R+) | |||
ABC7-42397700H18 | AP001533.4 | 99.09% | pos 33220 (R-) | AP000872.5 | 99.79% | pos 134839 (F+) |
ABC7-42407900O7 | AP001533.4 | 99.15% | pos 80174 (R+) | AP001533.4 | 99.06% | pos 122995 (F-) |
ABC7-42410200K14 | AP000872.5 | 98.56% | pos 57663 (R+) | AP000872.5 | 97.24% | pos 98264 (F-) |
ABC7-42412500D1 | AP001533.4 | 99.25% | pos 91843 (R+) | AP001533.4 | 99.72% | pos 129838 (F-) |
ABC7-42412900B16 | AP000872.5 | 97.84% | pos 43494 (R-) | AP000872.5 | 99.39% | pos 7829 (F+) |
ABC7-42419600M16 | AP001533.4 | 99.8% | pos 159682 (R-) | AP001533.4 | 99.34% | pos 125091 (F+) |
ABC7-42423100J2 | AP001533.4 | 98.98% | pos 156191 (R+) | AP001533.4 | 99.69% | pos 199416 (F-) |
ABC7-42429000G21 | AP001533.4 | 99.06% | pos 181320 (R+) | |||
ABC7-42431300J23 | AP001533.4 | 99.42% | pos 130576 (R-) | AP001533.4 | 99.45% | pos 86557 (F+) |
ABC7-42431500F3 | AP001533.4 | 99.67% | pos 21981 (R+) | AP001533.4 | 99.05% | pos 58716 (F-) |
ABC7-42436300C6 | AP000872.5 | 99.45% | pos 42964 (R+) | AP000872.5 | 99.23% | pos 77797 (F-) |
ABC7-42437400O18 | AP000872.5 | 100% | pos 104421 (R-) | |||
ABC7-42439900E9 | AP000872.5 | 99.09% | pos 90941 (R-) | AP000872.5 | 99.86% | pos 49376 (F+) |
ABC7-42440400N12 | AP000872.5 | 99.4% | pos 82443 (R+) | AP000872.5 | 98.76% | pos 117172 (F-) |
ABC7-42441700E22 | AP000872.5 | 99.45% | pos 118131 (R-) | AP000872.5 | 99.06% | pos 76030 (F+) |
ABC7-42442200L4 | AP001533.4 | 99.68% | pos 181331 (R+) | |||
ABC7-42444600B18 | AP001533.4 | 99.57% | pos 32203 (R-) | AP000872.5 | 99.64% | pos 133183 (F+) |
ABC7-42450600N22 | AP000872.5 | 100% | pos 127847 (R-) | AP000872.5 | 99.62% | pos 96006 (F+) |
ABC7-42452000G14 | AP000872.5 | 98.56% | pos 78179 (R-) | AP000872.5 | 99.15% | pos 39096 (F+) |
ABC7-42455800I6 | AP001533.4 | 97.08% | pos 44509 (F-) | |||
ABC7-42461900L9 | AP000872.5 | 100% | pos 24597 (R+) | AP000872.5 | 99.34% | pos 59176 (F-) |
ABC7-42462500N8 | AP000872.5 | 100% | pos 1330 (R+) | AP000872.5 | 99.74% | pos 35296 (F-) |
ABC7-42464900C16 | AP000872.5 | 100% | pos 104437 (R-) | AP000872.5 | 99.49% | pos 68206 (F+) |
ABC7-42466500I2 | AP001533.4 | 99.19% | pos 155308 (R+) | AP001533.4 | 99.74% | pos 190698 (F-) |
ABC7-42469600A22 | AP000872.5 | 99.28% | pos 52454 (R-) | AP000872.5 | 99.6% | pos 7940 (F+) |
ABC7-42471900B2 | AP001533.4 | 99.24% | pos 32203 (R-) | AP000872.5 | 98.58% | pos 133184 (F+) |
ABC7-42481300K24 | AP001533.4 | 99.34% | pos 124319 (R+) | AP001533.4 | 99.05% | pos 160004 (F-) |
ABC7-42481600G4 | AP000872.5 | 99.87% | pos 75544 (R-) | AP000872.5 | 99.51% | pos 44342 (F+) |
ABC7-42484500G23 | AP001533.4 | 99.58% | pos 130584 (R-) | AP001533.4 | 100% | pos 86560 (F+) |
ABC7-42488400H4 | AP000872.5 | 100% | pos 88686 (R+) | AP000872.5 | 98.51% | pos 132788 (F-) |
ABC7-42501800H10 | AP000872.5 | 99.87% | pos 26936 (R-) | |||
ABC7-42507000I4 | AP001533.4 | 99.61% | pos 178699 (F+) | |||
ABC7-42507100F7 | AP000872.5 | 98.93% | pos 144128 (R-) | AP000872.5 | 98.85% | pos 107911 (F+) |
AP001533.4 | 98.93% | pos 1967 (R-) | ||||
ABC7-42509600N11 | AP001533.4 | 99.17% | pos 15695 (R-) | AP000872.5 | 100% | pos 124945 (F+) |
ABC7-42515900B12 | AP001533.4 | 99.65% | pos 169428 (R-) | AP001533.4 | 99.6% | pos 132917 (F+) |
ABC7-42516500I6 | AP000872.5 | 98.08% | pos 26893 (R-) | |||
ABC7-42757000F13 | AP001533.4 | 99.62% | pos 134600 (R+) | AP001533.4 | 99.41% | pos 168307 (F-) |
ABC7-42760400F2 | AP001533.4 | 100% | pos 53704 (R-) | AP001533.4 | 99.44% | pos 20739 (F+) |
ABC7-43041800O20 | AP001533.4 | 100% | pos 142237 (R+) | AP001533.4 | 100% | pos 176814 (F-) |
ABC7-43042300O3 | AP000872.5 | 98.23% | pos 52843 (R-) | |||
ABC7-43044500K21 | AP000872.5 | 99.82% | pos 49816 (R-) | AP000872.5 | 100% | pos 6693 (F+) |
ABC7-43047000C24 | AP000872.5 | 98.79% | pos 142883 (R+) | AP001533.4 | 99.34% | pos 34544 (F-) |
AP001533.4 | 98.79% | pos 722 (R+) | ||||
ABC7-43048900M8 | AP001533.4 | 99.86% | pos 194544 (F+) | |||
ABC7-43049100N11 | AP001533.4 | 99.87% | pos 81154 (R-) | AP001533.4 | 99.86% | pos 48223 (F+) |
ABC7-43051700D19 | AP001533.4 | 99.6% | pos 164510 (R+) | AP001533.4 | 99.8% | pos 202710 (F-) |
ABC7-43056100B7 | AP001533.4 | 99.69% | pos 148522 (R-) | AP001533.4 | 98.61% | pos 108964 (F+) |
ABC7-43059000M1 | AP000872.5 | 100% | pos 26895 (R-) | |||
ABC7-43060500C1 | AP000872.5 | 99.48% | pos 57566 (R+) | AP000872.5 | 99.7% | pos 91099 (F-) |
ABC7-43066400M4 | AP000872.5 | 99.86% | pos 40883 (R-) | AP000872.5 | 100% | pos 7468 (F+) |
ABC7-43067900E10 | AP000872.5 | 98.07% | pos 65828 (R-) | AP000872.5 | 99.48% | pos 30710 (F+) |
ABC7-43070800M6 | AP000872.5 | 99.46% | pos 131399 (R-) | AP000872.5 | 100% | pos 92312 (F+) |
ABC7-43083300P9 | AP001533.4 | 100% | pos 172439 (R-) | AP001533.4 | 100% | pos 128272 (F+) |
ABC7-43090500F6 | AP001533.4 | 99.71% | pos 68939 (R-) | AP001533.4 | 98.99% | pos 39736 (F+) |
ABC7-43099600G4 | AP000872.5 | 99.87% | pos 8011 (R-) | |||
ABC7-475422I21 | AP001533.4 | 99.83% | pos 115737 (R-) | AP001533.4 | 99.69% | pos 79407 (F+) |
ABC7-491522D19 | AP000872.5 | 99.43% | pos 74540 (R+) | AP000872.5 | 99.37% | pos 111253 (F-) |
ABC7-497822I2 | AP000872.5 | 99.46% | pos 40860 (R-) | AP000872.5 | 98.98% | pos 7465 (F+) |
ABC7-498322M14 | AP001533.4 | 99.75% | pos 128795 (R+) | AP001533.4 | 100% | pos 162507 (F-) |
ABC7-610822J15 | AP000872.5 | 99.48% | pos 51669 (R+) | AP000872.5 | 99.87% | pos 88259 (F-) |
ABC7-614822H9 | AP001533.4 | 98.87% | pos 23803 (R-) | AP000872.5 | 99.52% | pos 129828 (F+) |
ABC7-620322K23 | AP000872.5 | 99.59% | pos 60782 (R-) | AP000872.5 | 99.66% | pos 30011 (F+) |
ABC7-621522C21 | AP000872.5 | 99.58% | pos 35065 (R+) | AP000872.5 | 97.04% | pos 76117 (F-) |
ABC7-623822O22 | AP001533.4 | 99.81% | pos 120485 (R+) | AP001533.4 | 99.62% | pos 159762 (F-) |
ABC8-2117740F22 | AP001533.4 | 100% | pos 176285 (F+) | |||
ABC8-2121840O15 | AP001533.4 | 99.56% | pos 196947 (R-) | AP001533.4 | 99.87% | pos 165440 (F+) |
ABC8-2133640M20 | AP000872.5 | 99.44% | pos 79394 (R+) | AP000872.5 | 99.86% | pos 120757 (F-) |
ABC8-2137840L2 | AP000872.5 | 99.02% | pos 28181 (F-) | |||
ABC8-2143740M12 | AP001533.4 | 99.86% | pos 135303 (R+) | AP001533.4 | 99.87% | pos 175196 (F-) |
ABC8-2144740H12 | AP001533.4 | 99.71% | pos 96509 (R+) | |||
ABC8-2148540M6 | AP001533.4 | 99.69% | pos 82144 (R+) | AP001533.4 | 99.7% | pos 119033 (F-) |
ABC8-2148640C1 | AP001533.4 | 99.84% | pos 197042 (R-) | AP001533.4 | 99.02% | pos 161182 (F+) |
ABC8-2149640M7 | AP001533.4 | 99.86% | pos 116342 (R-) | AP001533.4 | 99.85% | pos 78749 (F+) |
ABC8-2150440H9 | AP001533.4 | 99.45% | pos 148044 (R+) | AP001533.4 | 98.59% | pos 183547 (F-) |
ABC8-2159540H15 | AP000872.5 | 99.48% | pos 100056 (R+) | AP000872.5 | 99.19% | pos 134919 (F-) |
ABC8-2161840N2 | AP001533.4 | 99.49% | pos 195695 (R+) | |||
ABC8-2619140I1 | AP001533.4 | 99.86% | pos 25614 (R-) | AP000872.5 | 99.59% | pos 131593 (F+) |
ABC8-2619540I5 | AP001533.4 | 100% | pos 197191 (R+) | |||
ABC8-2621840A7 | AP001533.4 | 100% | pos 197502 (R+) | |||
ABC8-2625640H15 | AP001533.4 | 99.85% | pos 114097 (R-) | AP001533.4 | 99.74% | pos 70708 (F+) |
ABC8-2626240P9 | AP001533.4 | 99.87% | pos 67924 (R+) | AP001533.4 | 99.87% | pos 103431 (F-) |
ABC8-2678140E15 | AP001533.4 | 99.72% | pos 117728 (R+) | AP001533.4 | 99.09% | pos 152530 (F-) |
ABC8-40865200A9 | AP000872.5 | 100% | pos 87316 (R+) | AP000872.5 | 99.62% | pos 132054 (F-) |
ABC8-40870800C9 | AP000872.5 | 100% | pos 67462 (R-) | AP000872.5 | 99.44% | pos 30944 (F+) |
ABC8-40873500K11 | AP000872.5 | 99.86% | pos 85615 (R-) | AP000872.5 | 99.72% | pos 49221 (F+) |
ABC8-40873800A5 | AP000872.5 | 98.24% | pos 8527 (F-) | |||
ABC8-40873900O21 | AP000872.5 | 99.28% | pos 133325 (R-) | AP000872.5 | 98.85% | pos 98456 (F+) |
ABC8-40874100I14 | AP000872.5 | 99.71% | pos 107904 (R+) | AP000872.5 | 99.28% | pos 147790 (F-) |
AP001533.4 | 99.28% | pos 5629 (F-) | ||||
ABC8-40887200M6 | AP000872.5 | 99.32% | pos 18109 (R-) | |||
ABC8-40891500D6 | AP000872.5 | 99.68% | pos 1729 (R-) | |||
ABC8-40901400A12 | AP000872.5 | 99.17% | pos 134610 (F-) | |||
ABC8-40902100A9 | AP001533.4 | 99.74% | pos 124070 (F-) | |||
ABC8-40905700J4 | AP001533.4 | 100% | pos 36897 (R-) | AP000872.5 | 99.52% | pos 143955 (F+) |
AP001533.4 | 99.52% | pos 1794 (F+) | ||||
ABC8-40906600E16 | AP001533.4 | 99.72% | pos 86650 (R+) | AP001533.4 | 99.72% | pos 121592 (F-) |
ABC8-40924500M24 | AP001533.4 | 99.41% | pos 146941 (R-) | AP001533.4 | 99.55% | pos 113064 (F+) |
ABC8-40960500G2 | AP000872.5 | 98.75% | pos 82453 (R-) | AP000872.5 | 99.86% | pos 41728 (F+) |
ABC8-40968000G4 | AP001533.4 | 100% | pos 72972 (R-) | AP001533.4 | 99.85% | pos 35242 (F+) |
ABC8-40974200J18 | AP001533.4 | 99.31% | pos 86670 (R+) | AP001533.4 | 99.69% | pos 121546 (F-) |
ABC8-40975900C13 | AP001533.4 | 100% | pos 78004 (R-) | AP001533.4 | 99.85% | pos 42924 (F+) |
ABC8-40983600P16 | AP000872.5 | 98.03% | pos 143213 (F+) | |||
AP001533.4 | 98.03% | pos 1052 (F+) | ||||
ABC8-40984500B19 | AP000872.5 | 99.12% | pos 122762 (R-) | AP000872.5 | 100% | pos 87866 (F+) |
ABC8-40991800L2 | AP000872.5 | 99.23% | pos 16250 (R+) | AP000872.5 | 99.6% | pos 52268 (F-) |
ABC8-41020500B13 | AP001533.4 | 99.86% | pos 49158 (R-) | AP001533.4 | 100% | pos 15141 (F+) |
ABC8-41037900B6 | AP001533.4 | 97.21% | pos 44017 (R-) | AP000872.5 | 98.99% | pos 147427 (F+) |
AP001533.4 | 98.99% | pos 5266 (F+) | ||||
ABC8-41044300E21 | AP001533.4 | 98.49% | pos 62003 (R-) | AP001533.4 | 99.85% | pos 23028 (F+) |
ABC8-41051000G18 | AP001533.4 | 99.6% | pos 196920 (R-) | AP001533.4 | 100% | pos 157239 (F+) |
ABC8-41057600I21 | AP000872.5 | 99.58% | pos 56031 (R-) | AP000872.5 | 98.9% | pos 14789 (F+) |
ABC8-41061600M3 | AP000872.5 | 100% | pos 114411 (R-) | AP000872.5 | 98.42% | pos 82108 (F+) |
ABC8-41061700C18 | AP000872.5 | 99.73% | pos 133146 (R+) | AP001533.4 | 100% | pos 26305 (F-) |
ABC8-41061700E16 | AP000872.5 | 99.74% | pos 133137 (R+) | AP001533.4 | 99.86% | pos 26311 (F-) |
ABC8-41062100F1 | AP000872.5 | 99.86% | pos 5110 (F-) | |||
ABC8-41063500M15 | AP001533.4 | 99.72% | pos 119109 (R-) | AP001533.4 | 98.75% | pos 78904 (F+) |
ABC8-41064700F11 | AP000872.5 | 98.46% | pos 1738 (R-) | |||
ABC8-41066600G9 | AP001533.4 | 99.86% | pos 34429 (R-) | AP000872.5 | 99.39% | pos 137340 (F+) |
ABC8-41078800J2 | AP001533.4 | 100% | pos 189741 (R-) | AP001533.4 | 99.32% | pos 151154 (F+) |
ABC8-41079100B19 | AP001533.4 | 99.87% | pos 178164 (R+) | |||
ABC8-41079800L7 | AP001533.4 | 97.22% | pos 87205 (F-) | |||
ABC8-41083800M5 | AP001533.4 | 99.82% | pos 188623 (R-) | AP001533.4 | 99.34% | pos 157586 (F+) |
ABC8-41083900B10 | AP001533.4 | 99.75% | pos 188626 (R-) | AP001533.4 | 99.7% | pos 157578 (F+) |
ABC8-41084600D15 | AP000872.5 | 100% | pos 112976 (R+) | AP000872.5 | 99.86% | pos 150594 (F-) |
AP001533.4 | 99.86% | pos 8433 (F-) | ||||
ABC8-41088300J22 | AP001533.4 | 99.84% | pos 94260 (R+) | AP001533.4 | 100% | pos 129031 (F-) |
ABC8-41090300G8 | AP001533.4 | 98.77% | pos 25821 (R-) | AP000872.5 | 100% | pos 137088 (F+) |
ABC8-41091600A18 | AP001533.4 | 98.74% | pos 192775 (F+) | |||
ABC8-41107800M8 | AP000872.5 | 99.63% | pos 118041 (R+) | AP000872.5 | 99.87% | pos 152919 (F-) |
AP001533.4 | 99.87% | pos 10758 (F-) | ||||
ABC8-41115300E21 | AP001533.4 | 100% | pos 175379 (R-) | AP001533.4 | 99.09% | pos 137443 (F+) |
ABC8-41120000J16 | AP001533.4 | 99.69% | pos 104680 (R+) | AP001533.4 | 100% | pos 141473 (F-) |
ABC8-41123200I17 | AP001533.4 | 99.85% | pos 143147 (R-) | AP001533.4 | 99.21% | pos 106448 (F+) |
ABC8-41123600C20 | AP001533.4 | 98.77% | pos 62614 (R+) | AP001533.4 | 99.68% | pos 98796 (F-) |
ABC8-41126400F20 | AP001533.4 | 98.53% | pos 167577 (F+) | |||
ABC8-41130800L23 | AP000872.5 | 98.63% | pos 152796 (R+) | AP001533.4 | 99.44% | pos 46050 (F-) |
AP001533.4 | 98.63% | pos 10635 (R+) | ||||
ABC8-41132000M12 | AP001533.4 | 99.54% | pos 142907 (R+) | AP001533.4 | 99.23% | pos 179874 (F-) |
ABC8-41146500J5 | AP000872.5 | 99.23% | pos 35491 (R-) | AP000872.5 | 97.21% | pos 805 (F+) |
ABC8-41147400E1 | AP001533.4 | 99.19% | pos 74315 (R-) | AP001533.4 | 100% | pos 35949 (F+) |
ABC8-41147700M11 | AP000872.5 | 99.86% | pos 124494 (R+) | AP001533.4 | 99.85% | pos 18854 (F-) |
ABC8-41156800O22 | AP001533.4 | 100% | pos 179969 (R-) | |||
ABC8-41164000L1 | AP001533.4 | 99.43% | pos 151657 (R-) | AP001533.4 | 99.79% | pos 112735 (F+) |
ABC8-41169000L2 | AP000872.5 | 99.04% | pos 27989 (R-) | |||
ABC8-41171600E6 | AP001533.4 | 99.7% | pos 30603 (R-) | AP000872.5 | 99.22% | pos 133493 (F+) |
ABC8-41174500A23 | AP000872.5 | 100% | pos 145362 (R+) | AP001533.4 | 99.86% | pos 35418 (F-) |
AP001533.4 | 100% | pos 3201 (R+) | ||||
ABC8-41178300G5 | AP001533.4 | 99.72% | pos 34820 (R-) | AP000872.5 | 99.62% | pos 140384 (F+) |
ABC8-41179300B19 | AP001533.4 | 100% | pos 153540 (R-) | AP001533.4 | 99.53% | pos 116558 (F+) |
ABC8-41180100J20 | AP000872.5 | 100% | pos 143222 (R-) | AP000872.5 | 99.19% | pos 107610 (F+) |
AP001533.4 | 100% | pos 1061 (R-) | ||||
ABC8-41180400K5 | AP001533.4 | 98.89% | pos 148870 (R+) | AP001533.4 | 99.62% | pos 182957 (F-) |
ABC8-41181300C2 | AP000872.5 | 99.18% | pos 13190 (R-) | |||
AP000872.5 | 100% | pos 13209 (R-) | ||||
ABC8-41182400N7 | AP000872.5 | 99.68% | pos 2630 (R+) | AP000872.5 | 99.68% | pos 42587 (F-) |
ABC8-41185800P13 | AP000872.5 | 100% | pos 107712 (R+) | AP000872.5 | 99.57% | pos 144489 (F-) |
AP001533.4 | 99.57% | pos 2328 (F-) | ||||
ABC8-41190000E5 | AP000872.5 | 99.08% | pos 90897 (R+) | AP000872.5 | 100% | pos 128539 (F-) |
ABC8-41198000G16 | AP000872.5 | 98.83% | pos 32943 (R+) | AP000872.5 | 99.87% | pos 66509 (F-) |
ABC8-41198000P11 | AP000872.5 | 99.87% | pos 56863 (R+) | AP000872.5 | 99.83% | pos 93676 (F-) |
ABC8-41213400G6 | AP001533.4 | 99.24% | pos 68749 (R+) | AP001533.4 | 100% | pos 107104 (F-) |
ABC8-41213600C10 | AP001533.4 | 99.85% | pos 135623 (R-) | AP001533.4 | 100% | pos 98131 (F+) |
ABC8-41223000J6 | AP001533.4 | 98.92% | pos 157383 (R-) | AP001533.4 | 98.71% | pos 121104 (F+) |
ABC8-41228000I2 | AP000872.5 | 99.86% | pos 114413 (R+) | AP000872.5 | 99.86% | pos 148020 (F-) |
AP001533.4 | 99.86% | pos 5859 (F-) | ||||
ABC8-41789400I24 | AP000872.5 | 99.71% | pos 90974 (R+) | AP000872.5 | 99.52% | pos 131118 (F-) |
ABC8-41790100J14 | AP001533.4 | 99.86% | pos 71349 (R+) | AP001533.4 | 99.87% | pos 105003 (F-) |
ABC8-41791500D9 | AP000872.5 | 99.46% | pos 30610 (F-) | |||
ABC8-42066200J22 | AP000872.5 | 99.86% | pos 19912 (R-) | |||
ABC8-42072600G21 | AP000872.5 | 99.47% | pos 15760 (F-) | |||
ABC8-42075900I6 | AP000872.5 | 99.73% | pos 153772 (R+) | AP001533.4 | 99.19% | pos 47321 (F-) |
AP001533.4 | 99.73% | pos 11611 (R+) | ||||
ABC8-42076500O10 | AP001533.4 | 99.86% | pos 147459 (R+) | AP001533.4 | 99.73% | pos 183298 (F-) |
ABC8-42076900B17 | AP001533.4 | 100% | pos 124490 (R+) | AP001533.4 | 100% | pos 162465 (F-) |
ABC8-42077600I24 | AP000872.5 | 99.71% | pos 89537 (R+) | AP000872.5 | 99.35% | pos 126922 (F-) |
ABC8-42079100P5 | AP001533.4 | 100% | pos 72337 (R-) | AP001533.4 | 100% | pos 30332 (F+) |
ABC8-42082200H15 | AP000872.5 | 100% | pos 111767 (R-) | AP000872.5 | 99.27% | pos 77342 (F+) |
ABC8-42082300O4 | AP001533.4 | 100% | pos 182643 (R-) | AP001533.4 | 100% | pos 147692 (F+) |
ABC8-42082400D20 | AP001533.4 | 100% | pos 107664 (R-) | AP001533.4 | 100% | pos 68641 (F+) |
ABC8-42084100K5 | AP001533.4 | 99.45% | pos 79146 (R-) | AP001533.4 | 100% | pos 43857 (F+) |
ABC8-42090800H1 | AP000872.5 | 99.61% | pos 64378 (R-) | AP000872.5 | 99.68% | pos 28398 (F+) |
ABC8-42091600N14 | AP000872.5 | 99.23% | pos 43732 (R+) | AP000872.5 | 99.36% | pos 83079 (F-) |
ABC8-42095400N20 | AP001533.4 | 100% | pos 44793 (R+) | AP001533.4 | 99.71% | pos 75942 (F-) |
ABC8-42105800G19 | AP000872.5 | 99.57% | pos 70625 (R-) | AP000872.5 | 99.87% | pos 38813 (F+) |
ABC8-42109600K4 | AP001533.4 | 99.86% | pos 23876 (R+) | AP001533.4 | 99.5% | pos 59938 (F-) |
ABC8-42119300E19 | AP001533.4 | 99.86% | pos 116840 (R-) | AP001533.4 | 99.66% | pos 75164 (F+) |
ABC8-42129000N12 | AP001533.4 | 99.85% | pos 111950 (R-) | AP001533.4 | 99.87% | pos 74515 (F+) |
ABC8-42129000N16 | AP001533.4 | 99.18% | pos 111950 (R-) | AP001533.4 | 99.87% | pos 74509 (F+) |
ABC8-42532200H6 | AP000872.5 | 98.61% | pos 112625 (R-) | |||
ABC8-42546900G7 | AP001533.4 | 99.85% | pos 205752 (R+) | |||
ABC8-42975300H12 | AP000872.5 | 98.07% | pos 79268 (R-) | AP000872.5 | 99.58% | pos 36372 (F+) |
ABC8-42976300F17 | AP001533.4 | 99.63% | pos 129625 (R-) | AP001533.4 | 99.69% | pos 99586 (F+) |
ABC8-42976300M8 | AP001533.4 | 100% | pos 166626 (F+) | |||
ABC8-42999500N4 | AP000872.5 | 99.46% | pos 82277 (R+) | |||
ABC8-43001900J6 | AP000872.5 | 99.31% | pos 39751 (F-) | |||
ABC8-43008200J7 | AP000872.5 | 99.75% | pos 140513 (R-) | AP000872.5 | 98.63% | pos 107276 (F+) |
ABC8-43011700O5 | AP001533.4 | 99.74% | pos 102199 (R-) | AP001533.4 | 99.52% | pos 63035 (F+) |
ABC8-43014900C2 | AP000872.5 | 99.85% | pos 65769 (R+) | |||
ABC8-43017300O9 | AP001533.4 | 99.49% | pos 55339 (F-) | |||
ABC8-43021100J16 | AP000872.5 | 99.7% | pos 25104 (F-) | |||
ABC8-43023700O16 | AP000872.5 | 99.66% | pos 84889 (R+) | |||
ABC8-43033500P19 | AP001533.4 | 99.35% | pos 162179 (R+) | |||
ABC8-43092500I15 | AP000872.5 | 99.82% | pos 147338 (R+) | AP001533.4 | 99.6% | pos 46838 (F-) |
AP001533.4 | 99.82% | pos 5177 (R+) | ||||
ABC8-43092500K15 | AP000872.5 | 99.6% | pos 147372 (R+) | AP001533.4 | 99.8% | pos 46825 (F-) |
AP001533.4 | 99.6% | pos 5211 (R+) | ||||
ABC8-43204000L14 | AP001533.4 | 99.86% | pos 124272 (R-) | AP001533.4 | 100% | pos 84173 (F+) |
ABC8-43206400M8 | AP001533.4 | 99.87% | pos 166532 (F+) | |||
ABC8-43216100A19 | AP000872.5 | 98.63% | pos 76648 (R+) | AP000872.5 | 98.82% | pos 117588 (F-) |
ABC8-43216300J7 | AP001533.4 | 99.46% | pos 149460 (R-) | AP001533.4 | 100% | pos 113116 (F+) |
ABC8-43251000K12 | AP000872.5 | 99.85% | pos 109668 (R-) | AP000872.5 | 97.99% | pos 71101 (F+) |
ABC8-43252200E22 | AP000872.5 | 99.87% | pos 92818 (R+) | AP000872.5 | 99.6% | pos 132861 (F-) |
ABC8-43746300I19 | AP001533.4 | 99.73% | pos 200275 (R-) | AP001533.4 | 99.58% | pos 160535 (F+) |
AP001533.4 | 99.74% | pos 160520 (F+) | ||||
ABC8-43771400L17 | AP001533.4 | 98.52% | pos 160862 (R+) | AP001533.4 | 99.54% | pos 197880 (F-) |
ABC8-43775100F2 | AP001533.4 | 100% | pos 60063 (R+) | AP001533.4 | 99.84% | pos 97158 (F-) |
ABC8-43784100J7 | AP000872.5 | 99.73% | pos 55365 (R+) | AP000872.5 | 99.86% | pos 91410 (F-) |
ABC8-45033400I1 | AP001533.4 | 99.84% | pos 34830 (R-) | AP000872.5 | 99.72% | pos 140387 (F+) |
ABC8-45036000I15 | AP001533.4 | 99.73% | pos 61564 (R+) | AP001533.4 | 99.04% | pos 98903 (F-) |
ABC8-5698849P10 | AP001533.4 | 100% | pos 133631 (R+) | |||
ABC8-5699049E1 | AP001533.4 | 99.85% | pos 42894 (R-) | AP000872.5 | 99.16% | pos 153696 (F+) |
AP001533.4 | 99.16% | pos 11535 (F+) | ||||
ABC8-5717049G6 | AP000872.5 | 99.18% | pos 119788 (R+) | AP001533.4 | 99.49% | pos 19629 (F-) |
ABC8-647022I3 | AP000872.5 | 99.23% | pos 81271 (R-) | AP000872.5 | 100% | pos 41480 (F+) |
ABC8-651722G21 | AP000872.5 | 99.53% | pos 11651 (R+) | AP000872.5 | 99.66% | pos 44908 (F-) |
ABC8-651822P20 | AP000872.5 | 98.94% | pos 82458 (R-) | AP000872.5 | 99.7% | pos 41751 (F+) |
ABC8-701422L23 | AP001533.4 | 99.07% | pos 127105 (R-) | AP001533.4 | 99.45% | pos 91098 (F+) |
ABC8-703922J10 | AP000872.5 | 99.29% | pos 100800 (R-) | |||
ABC8-708622F9 | AP000872.5 | 99.16% | pos 99762 (R-) | AP000872.5 | 99.34% | pos 64090 (F+) |
ABC8-713622K16 | AP000872.5 | 99.68% | pos 112609 (R-) | AP000872.5 | 99.02% | pos 75719 (F+) |
ABC8-718640N9 | AP001533.4 | 100% | pos 174980 (R-) | AP001533.4 | 99.74% | pos 135172 (F+) |
ABC8-720240G19 | AP000872.5 | 99.18% | pos 78068 (R-) | AP000872.5 | 99.86% | pos 40649 (F+) |
ABC8-720640O11 | AP000872.5 | 99.58% | pos 114169 (R+) | AP000872.5 | 98.81% | pos 148812 (F-) |
AP001533.4 | 98.81% | pos 6651 (F-) | ||||
ABC8-720940I22 | AP000872.5 | 99.57% | pos 39140 (R+) | AP000872.5 | 99.05% | pos 72767 (F-) |
ABC8-723340N13 | AP001533.4 | 99.85% | pos 27867 (R-) | AP000872.5 | 99.7% | pos 135391 (F+) |
ABC8-723740J3 | AP000872.5 | 99.86% | pos 149282 (R-) | AP000872.5 | 99.87% | pos 116101 (F+) |
AP001533.4 | 99.86% | pos 7121 (R-) | ||||
ABC8-740440N23 | AP001533.4 | 98.38% | pos 113528 (R+) | AP001533.4 | 99.62% | pos 149416 (F-) |
ABC8-754622G23 | AP000872.5 | 99.85% | pos 145879 (R+) | AP001533.4 | 99.86% | pos 37434 (F-) |
AP001533.4 | 99.85% | pos 3718 (R+) | ||||
ABC8-755122F5 | AP001533.4 | 100% | pos 37679 (R+) | AP001533.4 | 99.73% | pos 73645 (F-) |
ABC8-756022K19 | AP001533.4 | 100% | pos 183588 (R-) | AP001533.4 | 100% | pos 148667 (F+) |
ABC8-773322M8 | AP000872.5 | 99.18% | pos 12550 (F-) | |||
ABC8-775222C16 | AP001533.4 | 99.73% | pos 47758 (R-) | AP000872.5 | 98.59% | pos 151173 (F+) |
AP001533.4 | 98.59% | pos 9012 (F+) | ||||
ABC8-787822N14 | AP001533.4 | 99.06% | pos 66775 (R-) | |||
ABC8-787822P16 | AP001533.4 | 100% | pos 31741 (F+) | |||
ABC8-790222J1 | AP000872.5 | 98.5% | pos 75048 (F-) | |||
ABC8-790622N8 | AP001533.4 | 99.59% | pos 104807 (R-) | AP001533.4 | 99.57% | pos 66805 (F+) |
ABC8-793722A14 | AP000872.5 | 98.84% | pos 60319 (R+) | AP000872.5 | 98.51% | pos 97350 (F-) |
ABC9-1269102P14 | AP001533.4 | 99.86% | pos 170673 (F-) | |||
ABC9-41238900K7 | AP001533.4 | 99.54% | pos 198054 (F+) | |||
ABC9-41245700D7 | AP000872.5 | 100% | pos 8423 (R+) | AP000872.5 | 99.15% | pos 47553 (F-) |
ABC9-41261000L14 | AP001533.4 | 99.37% | pos 22735 (R-) | AP000872.5 | 99.71% | pos 125777 (F+) |
ABC9-41279100K16 | AP000872.5 | 99.46% | pos 24998 (R-) | |||
ABC9-41280100B10 | AP001533.4 | 99.83% | pos 205232 (R+) | |||
ABC9-41281400E21 | AP001533.4 | 99.71% | pos 84914 (R-) | AP001533.4 | 99.67% | pos 49232 (F+) |
ABC9-41282300H23 | AP000872.5 | 98.36% | pos 51055 (R+) | AP000872.5 | 99.15% | pos 89609 (F-) |
ABC9-43323700J13 | AP000872.5 | 97.85% | pos 144082 (R-) | AP000872.5 | 99.13% | pos 105607 (F+) |
AP001533.4 | 97.85% | pos 1921 (R-) | ||||
ABC9-43350100L17 | AP001533.4 | 99.85% | pos 116902 (R-) | AP001533.4 | 99.58% | pos 76161 (F+) |
ABC9-43351100B19 | AP000872.5 | 99.73% | pos 31256 (F-) | |||
ABC9-43812600A15 | AP000872.5 | 99.5% | pos 80501 (R+) | AP000872.5 | 99.76% | pos 122901 (F-) |
ABC9-43821200J14 | AP000872.5 | 98.85% | pos 51030 (R+) | AP000872.5 | 98.75% | pos 89607 (F-) |
ABC9-43821400M2 | AP000872.5 | 99.57% | pos 99847 (R-) | AP000872.5 | 99.7% | pos 61983 (F+) |
ABC9-43826700E18 | AP000872.5 | 100% | pos 32650 (F-) | |||
ABC9-43827000F16 | AP001533.4 | 99.31% | pos 179070 (F+) | |||
ABC9-43832100O17 | AP000872.5 | 99.28% | pos 46395 (R-) | AP000872.5 | 99.35% | pos 1741 (F+) |
ABC9-43835300G22 | AP001533.4 | 100% | pos 84939 (R-) | AP001533.4 | 99.57% | pos 49225 (F+) |
ABC9-43835900O12 | AP001533.4 | 100% | pos 31687 (R+) | AP001533.4 | 99.73% | pos 70995 (F-) |
ABC9-43836600G1 | AP000872.5 | 99.86% | pos 34203 (R-) | |||
ABC9-43838200B16 | AP000872.5 | 100% | pos 98357 (R+) | AP000872.5 | 99.87% | pos 137047 (F-) |
ABC9-43841200J15 | AP001533.4 | 100% | pos 30488 (R+) | AP001533.4 | 99.31% | pos 68986 (F-) |
ABC9-43845000F22 | AP001533.4 | 99.86% | pos 191188 (F+) | |||
ABC9-43845900H2 | AP000872.5 | 100% | pos 98371 (R+) | AP000872.5 | 99.73% | pos 137050 (F-) |
ABC9-43846000N12 | AP000872.5 | 99.72% | pos 19781 (R-) | |||
ABC9-43849000L7 | AP000872.5 | 99.85% | pos 4069 (F-) | |||
ABC9-43854000A8 | AP000872.5 | 99.15% | pos 130704 (R+) | AP001533.4 | 99.08% | pos 30230 (F-) |
ABC9-43861000H3 | AP000872.5 | 99.18% | pos 76091 (R+) | AP000872.5 | 100% | pos 115450 (F-) |
ABC9-43872700I5 | AP000872.5 | 99.86% | pos 26194 (R-) | |||
ABC9-43880200E8 | AP000872.5 | 99.04% | pos 65753 (R-) | AP000872.5 | 99.73% | pos 26123 (F+) |
ABC9-43880600I14 | AP000872.5 | 99.86% | pos 98351 (R+) | AP000872.5 | 100% | pos 137043 (F-) |
ABC9-43884800A18 | AP000872.5 | 98.57% | pos 65753 (R-) | AP000872.5 | 100% | pos 26126 (F+) |
ABC9-43885400P22 | AP000872.5 | 99.25% | pos 79729 (R+) | AP000872.5 | 100% | pos 123222 (F-) |
ABC9-43887300N22 | AP001533.4 | 100% | pos 191188 (F+) | |||
ABC9-43903700I18 | AP001533.4 | 99.85% | pos 153907 (R+) | AP001533.4 | 99.68% | pos 194511 (F-) |
ABC9-43915000D18 | AP001533.4 | 99.86% | pos 42065 (R+) | AP001533.4 | 100% | pos 82562 (F-) |
ABC9-43918100I16 | AP000872.5 | 99.23% | pos 72688 (R-) | AP000872.5 | 99.72% | pos 34388 (F+) |
ABC9-43918100J19 | AP000872.5 | 98.63% | pos 150173 (R+) | AP001533.4 | 98.18% | pos 46459 (F-) |
AP001533.4 | 98.63% | pos 8012 (R+) | ||||
ABC9-43918400A1 | AP001533.4 | 99.85% | pos 71636 (R-) | AP001533.4 | 99.17% | pos 30143 (F+) |
ABC9-43920400I24 | AP001533.4 | 99.71% | pos 155886 (R-) | AP001533.4 | 100% | pos 117287 (F+) |
ABC9-43927300D15 | AP001533.4 | 100% | pos 137299 (R-) | AP001533.4 | 99.85% | pos 97630 (F+) |
ABC9-43931800N7 | AP000872.5 | 100% | pos 92955 (R-) | AP000872.5 | 99.35% | pos 53495 (F+) |
ABC9-43934800G6 | AP001533.4 | 99.85% | pos 116878 (R-) | AP001533.4 | 99.74% | pos 76152 (F+) |
ABC9-43939600K16 | AP000872.5 | 99.36% | pos 117478 (R-) | AP000872.5 | 99.07% | pos 81087 (F+) |
ABC9-43939700P22 | AP001533.4 | 99.83% | pos 157291 (R+) | AP001533.4 | 99.72% | pos 196504 (F-) |
ABC9-43940500H7 | AP001533.4 | 99.48% | pos 82463 (R+) | AP001533.4 | 99.28% | pos 124674 (F-) |
ABC9-43953800N14 | AP000872.5 | 98.44% | pos 35227 (R+) | AP000872.5 | 98.51% | pos 76146 (F-) |
ABC9-43960000P19 | AP001533.4 | 100% | pos 99214 (R-) | AP001533.4 | 99.68% | pos 59576 (F+) |
ABC9-43960200F11 | AP000872.5 | 99.86% | pos 88631 (R+) | AP000872.5 | 99.59% | pos 131317 (F-) |
ABC9-43988600E22 | AP001533.4 | 100% | pos 145289 (R+) | AP001533.4 | 99.57% | pos 187588 (F-) |
ABC9-43991200F20 | AP001533.4 | 100% | pos 105355 (R+) | AP001533.4 | 98.71% | pos 144182 (F-) |
ABC9-43992900O17 | AP001533.4 | 99.87% | pos 116700 (R-) | AP001533.4 | 100% | pos 78892 (F+) |
ABC9-43994300N15 | AP001533.4 | 100% | pos 112444 (R+) | AP001533.4 | 99.86% | pos 151482 (F-) |
ABC9-43999600M10 | AP000872.5 | 99.51% | pos 11814 (F-) | |||
ABC9-43999900D11 | AP001533.4 | 99.86% | pos 39795 (R-) | AP000872.5 | 99.14% | pos 144230 (F+) |
AP001533.4 | 99.14% | pos 2069 (F+) | ||||
ABC9-44002700J2 | AP000872.5 | 99.87% | pos 155913 (R+) | AP001533.4 | 99.64% | pos 55237 (F-) |
AP001533.4 | 99.87% | pos 13752 (R+) | ||||
ABC9-44004100P13 | AP001533.4 | 97.45% | pos 203749 (R+) | |||
ABC9-44005500I6 | AP001533.4 | 99.73% | pos 201306 (R-) | AP001533.4 | 99.49% | pos 165439 (F+) |
ABC9-44007100A20 | AP000872.5 | 99.65% | pos 94007 (R+) | AP000872.5 | 98.52% | pos 131656 (F-) |
ABC9-44008200K7 | AP001533.4 | 99.51% | pos 62603 (R-) | AP001533.4 | 99.29% | pos 19067 (F+) |
ABC9-44014000I19 | AP001533.4 | 99.85% | pos 203455 (R+) | |||
ABC9-44023200N23 | AP000872.5 | 98.3% | pos 134718 (R-) | AP000872.5 | 98.48% | pos 92945 (F+) |
ABC9-44030000K1 | AP001533.4 | 99.83% | pos 181381 (F+) | |||
ABC9-44033000A14 | AP001533.4 | 99.86% | pos 146396 (R+) | AP001533.4 | 100% | pos 186898 (F-) |
ABC9-44034000O5 | AP001533.4 | 99.53% | pos 183328 (F-) | |||
ABC9-44035400J5 | AP001533.4 | 98.58% | pos 80353 (R-) | AP001533.4 | 99.86% | pos 37304 (F+) |
ABC9-44044000C19 | AP001533.4 | 98.43% | pos 145282 (R+) | AP001533.4 | 99.54% | pos 187598 (F-) |
ABC9-44044800J6 | AP001533.4 | 99.15% | pos 165174 (R-) | AP001533.4 | 99.73% | pos 126225 (F+) |
ABC9-44049600K18 | AP001533.4 | 99.51% | pos 155897 (R-) | AP001533.4 | 100% | pos 117277 (F+) |
ABC9-45238100B4 | AP001533.4 | 99.85% | pos 48535 (R-) | AP000872.5 | 100% | pos 149246 (F+) |
AP001533.4 | 100% | pos 7085 (F+) | ||||
ABC9-45392800D19 | AP001533.4 | 99.11% | pos 146024 (R-) | AP001533.4 | 100% | pos 104320 (F+) |
ABC9-45429900G24 | AP001533.4 | 99.84% | pos 153924 (R+) | AP001533.4 | 100% | pos 194531 (F-) |
ABC9-45469100M21 | AP001533.4 | 99.78% | pos 123825 (R-) | AP001533.4 | 99.48% | pos 83232 (F+) |
ABC9-45472300A2 | AP000872.5 | 99.61% | pos 36401 (R+) | AP000872.5 | 98.56% | pos 73219 (F-) |
ABC9-45485100A4 | AP001533.4 | 99.63% | pos 99195 (R-) | AP001533.4 | 99.03% | pos 59594 (F+) |
ABC9-45486000M20 | AP000872.5 | 99.84% | pos 108289 (R+) | AP000872.5 | 100% | pos 146737 (F-) |
AP001533.4 | 100% | pos 4576 (F-) | ||||
ABC9-45489500G18 | AP000872.5 | 98.23% | pos 36409 (R+) | AP000872.5 | 98.09% | pos 73218 (F-) |
ABC9-45901000E14 | AP000872.5 | 99.45% | pos 51011 (R+) | AP000872.5 | 99.37% | pos 89598 (F-) |
ABC9-45917500K17 | AP000872.5 | 99.87% | pos 61515 (R+) | AP000872.5 | 100% | pos 100190 (F-) |
ABC9-45918000F7 | AP000872.5 | 99.86% | pos 57995 (R-) | AP000872.5 | 99.86% | pos 18732 (F+) |
ABC9-45918000P11 | AP000872.5 | 99.72% | pos 57997 (R-) | AP000872.5 | 99.86% | pos 18749 (F+) |
ABC9-45918700K5 | AP000872.5 | 100% | pos 26194 (R-) | |||
ABC9-45921900P9 | AP000872.5 | 99.84% | pos 99846 (R-) | AP000872.5 | 99.62% | pos 61988 (F+) |
ABC9-45922600F22 | AP001533.4 | 99.61% | pos 150329 (R+) | AP001533.4 | 100% | pos 191778 (F-) |
ABC9-46181700F10 | AP000872.5 | 99.69% | pos 30616 (F-) | |||
ABC9-46211100M21 | AP000872.5 | 99.22% | pos 55592 (R+) | AP000872.5 | 100% | pos 95124 (F-) |
ABC9-46212700H16 | AP001533.4 | 99.86% | pos 137684 (R-) | AP001533.4 | 99.78% | pos 97629 (F+) |
ABC9-46213500N6 | AP001533.4 | 97.98% | pos 187104 (F+) | |||
ABC9-46216900M7 | AP001533.4 | 99.85% | pos 125443 (R-) | AP001533.4 | 99.45% | pos 88927 (F+) |
ABC9-46218800K6 | AP001533.4 | 99.7% | pos 125444 (R-) | AP001533.4 | 100% | pos 88922 (F+) |
ABC9-560714J21 | AP001533.4 | 98.86% | pos 173601 (F+) | |||
ABC9-580412G8 | AP000872.5 | 99.39% | pos 89869 (R-) | AP000872.5 | 99.71% | pos 46902 (F+) |
G248P80046C7 | AP001533.4 | 99.19% | pos 176078 (R-) | AP001533.4 | 98.6% | pos 140158 (F+) |
G248P801734A7 | AP001533.4 | 99.06% | pos 179970 (R+) | |||
WI2-0401K14 | AP000872.5 | 99.15% | pos 60295 (R-) | AP000872.5 | 99.6% | pos 18905 (F+) |
WI2-0412J21 | AP000872.5 | 100% | pos 147332 (R+) | AP001533.4 | 98.73% | pos 40762 (F-) |
AP001533.4 | 100% | pos 5171 (R+) | ||||
WI2-0424G17 | AP001533.4 | 99.73% | pos 36797 (R+) | AP001533.4 | 99.05% | pos 73758 (F-) |
WI2-0426N22 | AP001533.4 | 97.37% | pos 73759 (F-) | |||
WI2-0510O24 | AP001533.4 | 98.39% | pos 150510 (R+) | |||
WI2-0549F21 | AP001533.4 | 97.75% | pos 68217 (R-) | AP001533.4 | 99.15% | pos 29941 (F+) |
WI2-0559J17 | AP001533.4 | 98.85% | pos 134867 (R-) | AP001533.4 | 99.29% | pos 96085 (F+) |
WI2-0608P11 | AP000872.5 | 99.67% | pos 86223 (R+) | AP000872.5 | 99.28% | pos 122634 (F-) |
WI2-0624H22 | AP000872.5 | 99.8% | pos 56708 (R-) | AP000872.5 | 99.56% | pos 18401 (F+) |
WI2-0630J02 | AP001533.4 | 100% | pos 162097 (R-) | AP001533.4 | 99.38% | pos 119640 (F+) |
WI2-0633M18 | AP000872.5 | 99.43% | pos 155914 (R-) | AP000872.5 | 99.84% | pos 113678 (F+) |
AP001533.4 | 99.43% | pos 13753 (R-) | ||||
WI2-0635J21 | AP000872.5 | 99.83% | pos 14596 (F-) | |||
WI2-0686G11 | AP000872.5 | 99.34% | pos 90350 (R+) | AP000872.5 | 98.1% | pos 129416 (F-) |
WI2-0734A12 | AP000872.5 | 98.29% | pos 12245 (R+) | AP000872.5 | 99.5% | pos 49613 (F-) |
WI2-0734L05 | AP001533.4 | 100% | pos 107641 (R+) | AP001533.4 | 99.71% | pos 146968 (F-) |
WI2-0749F05 | AP001533.4 | 99.29% | pos 86839 (F+) | |||
WI2-0757E19 | AP001533.4 | 100% | pos 107326 (R+) | AP001533.4 | 99.71% | pos 150441 (F-) |
WI2-0822D16 | AP001533.4 | 99.24% | pos 123307 (R-) | AP001533.4 | 98.68% | pos 86830 (F+) |
WI2-0856O21 | AP000872.5 | 100% | pos 146560 (F-) | |||
AP001533.4 | 100% | pos 4399 (F-) | ||||
WI2-0864O06 | AP001533.4 | 100% | pos 174243 (F+) | |||
WI2-0990H16 | AP000872.5 | 99.18% | pos 95065 (R+) | AP000872.5 | 99.03% | pos 135328 (F-) |
WI2-1001O09 | AP001533.4 | 99.68% | pos 118993 (R-) | |||
WI2-1014D14 | AP001533.4 | 100% | pos 118961 (R-) | AP001533.4 | 100% | pos 81978 (F+) |
WI2-1069H01 | AP000872.5 | 99.57% | pos 110608 (R+) | AP000872.5 | 98.85% | pos 147160 (F-) |
AP001533.4 | 98.85% | pos 4999 (F-) | ||||
WI2-1078O08 | AP001533.4 | 97.6% | pos 184118 (R+) | |||
WI2-1089P04 | AP001533.4 | 99.27% | pos 15753 (F+) | |||
WI2-1105N06 | AP001533.4 | 100% | pos 178904 (R+) | |||
WI2-1114N09 | AP000872.5 | 99.62% | pos 37182 (R-) | |||
WI2-1114P11 | AP000872.5 | 99.75% | pos 37182 (R-) | |||
WI2-1249J05 | AP000872.5 | 99.83% | pos 32851 (R+) | AP000872.5 | 98.54% | pos 71410 (F-) |
WI2-1371M02 | AP000872.5 | 99.08% | pos 62666 (F+) | |||
WI2-1409C04 | AP001533.4 | 100% | pos 47158 (R+) | |||
WI2-1488J24 | AP001533.4 | 99.53% | pos 84464 (R-) | AP001533.4 | 100% | pos 42751 (F+) |
WI2-1498E23 | AP000872.5 | 98.79% | pos 101116 (F+) | |||
WI2-1498O03 | AP000872.5 | 99.3% | pos 101020 (F+) | |||
WI2-1514L16 | AP000872.5 | 98.74% | pos 68252 (F-) | |||
WI2-1515I01 | AP000872.5 | 97.44% | pos 88686 (F+) | |||
WI2-1635H12 | AP001533.4 | 100% | pos 149089 (F-) | |||
WI2-1639F18 | AP001533.4 | 100% | pos 61014 (F-) | |||
WI2-1712B05 | AP001533.4 | 99.37% | pos 205965 (F-) | |||
WI2-1717N17 | AP000872.5 | 99.85% | pos 11689 (R+) | AP000872.5 | 98.97% | pos 53936 (F-) |
WI2-1864F13 | AP000872.5 | 100% | pos 27889 (R-) | |||
WI2-1967B23 | AP001533.4 | 100% | pos 168743 (R+) | |||
WI2-1970L14 | AP000872.5 | 99.85% | pos 50096 (R-) | AP000872.5 | 99.66% | pos 11330 (F+) |
WI2-2008N06 | AP000872.5 | 98.18% | pos 152020 (R-) | AP000872.5 | 99.57% | pos 115159 (F+) |
AP001533.4 | 98.18% | pos 9859 (R-) | ||||
WI2-2021J02 | AP000872.5 | 98.82% | pos 84345 (R+) | |||
WI2-2028G01 | AP001533.4 | 98.02% | pos 106149 (F-) | |||
WI2-2028H14 | AP001533.4 | 99.83% | pos 114262 (R-) | |||
WI2-2110A07 | AP000872.5 | 100% | pos 34182 (R+) | AP000872.5 | 100% | pos 75529 (F-) |
WI2-2204H12 | AP000872.5 | 99.35% | pos 32014 (R-) | |||
WI2-2235D20 | AP001533.4 | 99.66% | pos 115913 (R-) | AP001533.4 | 98.89% | pos 81347 (F+) |
WI2-2374N22 | AP000872.5 | 99.22% | pos 12410 (R-) | |||
WI2-2407H12 | AP000872.5 | 99.85% | pos 17548 (R-) | |||
WI2-2418M13 | AP001533.4 | 99.05% | pos 167662 (R-) | AP001533.4 | 99.51% | pos 129508 (F+) |
WI2-2428O06 | AP001533.4 | 99.52% | pos 168018 (F-) | |||
WI2-2433I23 | AP000872.5 | 99.42% | pos 45498 (R+) | AP000872.5 | 98.77% | pos 83661 (F-) |
WI2-2449N23 | AP001533.4 | 98.75% | pos 155933 (R-) | AP001533.4 | 99.78% | pos 114654 (F+) |
WI2-2527I09 | AP000872.5 | 98.8% | pos 82615 (R-) | AP000872.5 | 99.21% | pos 41372 (F+) |
WI2-2580I06 | AP001533.4 | 99.64% | pos 118851 (R+) | AP001533.4 | 99.34% | pos 162288 (F-) |
WI2-2583G19 | AP000872.5 | 98.48% | pos 82607 (R-) | AP000872.5 | 99.45% | pos 41406 (F+) |
WI2-2627K24 | AP001533.4 | 98.91% | pos 68696 (R-) | AP001533.4 | 100% | pos 31683 (F+) |
WI2-2662D24 | AP001533.4 | 98.81% | pos 171941 (R+) | |||
WI2-2838B18 | AP001533.4 | 99.69% | pos 203870 (R-) | AP001533.4 | 99.37% | pos 169248 (F+) |
WI2-2950P09 | AP000872.5 | 99.84% | pos 10779 (F-) | |||
WI2-2963A05 | AP001533.4 | 99.2% | pos 159304 (R+) | AP001533.4 | 99.52% | pos 196492 (F-) |
WI2-2987D16 | AP000872.5 | 99.32% | pos 144318 (R-) | AP000872.5 | 99.31% | pos 104878 (F+) |
AP001533.4 | 99.32% | pos 2157 (R-) | ||||
WI2-3048B02 | AP001533.4 | 98.62% | pos 29167 (R-) | AP000872.5 | 98.42% | pos 131044 (F+) |
WI2-3054A17 | AP000872.5 | 98.67% | pos 12160 (R+) | AP000872.5 | 100% | pos 49460 (F-) |
WI2-3073B22 | AP001533.4 | 99.1% | pos 27615 (F+) | |||
WI2-3076G05 | AP001533.4 | 98.9% | pos 194957 (F+) | |||
WI2-3076K05 | AP001533.4 | 99.48% | pos 194957 (F+) | |||
WI2-3128J10 | AP001533.4 | 99.52% | pos 114948 (R-) | AP001533.4 | 99.49% | pos 77230 (F+) |
WI2-3190F11 | AP001533.4 | 99.84% | pos 186902 (R-) | AP001533.4 | 98.77% | pos 146910 (F+) |
WI2-3198F13 | AP001533.4 | 99.26% | pos 83613 (R-) | AP001533.4 | 99.72% | pos 41420 (F+) |
WI2-3198P11 | AP001533.4 | 99.5% | pos 83604 (R-) | AP001533.4 | 99.71% | pos 41398 (F+) |
WI2-3234K19 | AP000872.5 | 99.66% | pos 53494 (R-) | |||
WI2-3242F12 | AP001533.4 | 99.67% | pos 168953 (R+) | |||
WI2-3279H23 | AP001533.4 | 99.34% | pos 180540 (R+) | |||
WI2-3319F02 | AP001533.4 | 100% | pos 64832 (R-) | AP001533.4 | 100% | pos 23149 (F+) |
WI2-3319L16 | AP001533.4 | 99.83% | pos 64830 (R-) | AP001533.4 | 100% | pos 23150 (F+) |
WI2-3402A03 | AP000872.5 | 99.19% | pos 4594 (F-) | |||
WI2-3421B20 | AP000872.5 | 99.7% | pos 120536 (F-) | |||
WI2-3487P06 | AP000872.5 | 98.87% | pos 71921 (R+) | AP000872.5 | 100% | pos 112589 (F-) |
WI2-3603E11 | AP001533.4 | 98% | pos 177458 (F+) | |||
WI2-3621N19 | AP000872.5 | 99.37% | pos 28873 (F-) | |||
WI2-3624O08 | AP001533.4 | 99.8% | pos 157063 (R-) | |||
WI2-3764I04 | AP000872.5 | 99.57% | pos 3949 (R+) | AP000872.5 | 99.68% | pos 43640 (F-) |
WI2-3776O11 | AP001533.4 | 99.53% | pos 16141 (R-) | |||
WI2-3781E20 | AP001533.4 | 100% | pos 176405 (R+) | |||
WI2-3781K06 | AP001533.4 | 100% | pos 81378 (R+) | AP001533.4 | 99.64% | pos 119587 (F-) |