PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:41450 Links WI-15169 Homo sapiens chromosome 12, locus HSP90B1 Macaca mulatta chromosome 11, locus HSP90B1 Pan troglodytes chromosome 12, locus TRA1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GAAACGTATGAACCCTAAAATTGG Reverse primer: GCATGTCTCTGATCAGCGG PCR product size: 126 (bp), Homo sapiens GenBank Accession: H41663    Homo sapiens Name: WI-15169 Also known as: EST302714 Polymorphism info:   Cross References Gene GeneID: 7184   Symbol: HSP90B1   Description: heat shock protein 90kDa beta (Grp94), member 1   Position: 12q24.2-q24.3 UniGene Hs.192374 Heat shock protein 90kDa beta (Grp94), member 1 Mapping Information WI-15169 Sequence Map: Chr 12|HuRef Map Viewer   Position: 101400071-101400196 (bp)   WI-15169 Sequence Map: Chr 12 Map Viewer   Position: 102864465-102864590 (bp)   WI-15169 Sequence Map: Chr 12|Celera Map Viewer   Position: 104004105-104004230 (bp)   WI-15169 NCBI RH Map: Chr 12 Map Viewer   Position: 689.3 (cR)   Lod score: 3.31   WI-15169 Whitehead-RH Map: Chr 12 Map Viewer   Position: 501.5 (cR3000)   Lod score: P0.34   WI-15169 GeneMap99-GB4 Map: Chr 12 Map Viewer   Position: 409.52 (cR3000)   Lod score: 0.59   Reference Interval: D12S78-D12S79 Electronic PCR results Genomic (5 of 7)[Show All Hits] AC078819.24 23129 .. 23254 (126 bp)   CH003459.1 101747612 .. 101747737 (126 bp)   CH003507.1 107365019 .. 107365144 (126 bp)   CH471054.1 51627934 .. 51628059 (126 bp)   CM000263.1 104004105 .. 104004230 (126 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC013776.4 45979 .. 46104 (126 bp)     ESTs (5 of 6)[Show All Hits] H41663.1 17 .. 142 (126 bp)   H44085.1 38 .. 163 (126 bp)   BE830129.1 384 .. 509 (126 bp)   BE830182.1 384 .. 509 (126 bp)   CD512590.1 190 .. 315 (126 bp)     Whole Genome Shotgun sequences (4) AADD01127525.1 19634 .. 19759 (126 bp)   AADC01109270.1 28277 .. 28402 (126 bp)   AADB02015496.1 34376 .. 34501 (126 bp)   ABBA01053210.1 13030 .. 13155 (126 bp)        Macaca mulatta Name: WI-15169 Polymorphism info:   Cross References Gene GeneID: 699568   Symbol: HSP90B1   Description: tumor rejection antigen (gp96) 1   Position:   Mapping Information WI-15169 Sequence Map: Chr 11 Map Viewer   Position: 105060600-105060725 (bp)    Pan troglodytes Name: WI-15169 Polymorphism info:   Cross References Gene GeneID: 452187   Symbol: TRA1   Description: tumor rejection antigen (gp96) 1   Position:   Mapping Information WI-15169 Sequence Map: Chr 12 Map Viewer   Position: 105074238-105074361 (bp) Electronic PCR results Genomic (1) CM000326.1 105074238 .. 105074361 (124 bp)     Whole Genome Shotgun sequences (2) AADA01183464.1 14442 .. 14565 (124 bp)   AACZ02137357.1 9671 .. 9794 (124 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement