PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:11531 Links SHGC-77696 Homo sapiens chromosome 3, locus FBXO45 Pan troglodytes chromosome 3, locus FBXO45 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AGAATCTTGGCATACGGAACC Reverse primer: AGACAGTTGCGCCTGAAGAT PCR product size: 132 (bp), Homo sapiens    Homo sapiens Name: SHGC-77696 Also known as: stSG22493 Polymorphism info:   Cross References Gene GeneID: 200933   Symbol: FBXO45   Description: F-box protein 45   Position: 3q29 UniGene Hs.169815 F-box protein 45 Mapping Information SHGC-77696 Sequence Map: Chr 3|HuRef Map Viewer   Position: 193610964-193611095 (bp)   SHGC-77696 Sequence Map: Chr 3|Celera Map Viewer   Position: 194895552-194895683 (bp)   SHGC-77696 Sequence Map: Chr 3 Map Viewer   Position: 197797912-197798043 (bp)   stSG22493 NCBI RH Map: Chr 3 Map Viewer   Position: 2009 (cR)   Lod score: 2.39   SHGC-77696 TNG Map: Chr 3 Map Viewer   Position: 109050 (cR50000)   Lod score: 14.5   Reference Interval: 257   stSG22493 GeneMap99-GB4 Map: Chr 3 Map Viewer   Position: 728.72 (cR3000)   Lod score: 0.00   Reference Interval: D3S1265-qTEL Electronic PCR results RefSeq mRNA (1) NM_001105573.1 3318 .. 3449 (132 bp)     mRNA (1) AK025697.1 3044 .. 3175 (132 bp)     Genomic (5 of 7)[Show All Hits] AC092933.21 97480 .. 97611 (132 bp)   CH003450.1 194534458 .. 194534589 (132 bp)   CH003498.1 202058835 .. 202058966 (132 bp)   CH471191.2 577032 .. 577163 (132 bp)   CM000254.1 194895552 .. 194895683 (132 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC023415.3 33899 .. 34030 (132 bp)   AC131148.2 146080 .. 146211 (132 bp)     ESTs (5 of 39)[Show All Hits] Z40309.1 127 .. 258 (132 bp)   N74976.1 121 .. 252 (132 bp)   AA126446.1 120 .. 251 (132 bp)   AA287270.1 120 .. 251 (132 bp)   AA425408.1 37 .. 168 (132 bp)     Whole Genome Shotgun sequences (4) AADD01042131.1 12461 .. 12592 (132 bp)   AADC01037627.1 1451 .. 1582 (132 bp)   AADB02005856.1 5664 .. 5795 (132 bp)   ABBA01033744.1 56991 .. 57122 (132 bp)        Pan troglodytes Name: SHGC-77696 Polymorphism info:   Cross References Gene GeneID: 471091   Symbol: FBXO45   Description: F-box protein 45   Position:   Mapping Information SHGC-77696 Sequence Map: Chr 3 Map Viewer   Position: 202225082-202225213 (bp) Electronic PCR results RefSeq mRNA (1) XM_526475.2 3607 .. 3738 (132 bp)     Genomic (1) CM000317.1 202225082 .. 202225213 (132 bp)     Whole Genome Shotgun sequences (2) AADA01066937.1 10352 .. 10483 (132 bp)   AACZ02043870.1 11702 .. 11833 (132 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement