PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:76966 Links RH78111 Homo sapiens chromosome 12, locus GLTP Macaca mulatta chromosome 11 Pan troglodytes chromosome 12, locus GLTP Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTAGCGCCAGGAAGAACAGT Reverse primer: ACAATTGACCCATAGATGACCC PCR product size: 188 (bp), Homo sapiens    Homo sapiens Name: RH78111 Also known as: stSG40401 Polymorphism info:   Cross References Gene GeneID: 51228   Symbol: GLTP   Description: glycolipid transfer protein   Position: 12q24.11 UniGene Hs.381256 Glycolipid transfer protein   Hs.674386 Transcribed locus Mapping Information RH78111 Sequence Map: Chr 12|HuRef Map Viewer   Position: 107304755-107304941 (bp)   RH78111 Sequence Map: Chr 12 Map Viewer   Position: 108773286-108773472 (bp)   RH78111 Sequence Map: Chr 12|Celera Map Viewer   Position: 109913259-109913445 (bp)   stSG40401 NCBI RH Map: Chr 12 Map Viewer   Position: 704.8 (cR)   Lod score: 1.24   stSG40401 GeneMap99-GB4 Map: Chr 12 Map Viewer   Position: 426.34 (cR3000)   Lod score: 1.11   Reference Interval: D12S78-D12S79 Electronic PCR results RefSeq mRNA (1) NM_016433.3 2015 .. 2201 (187 bp)     Genomic (5 of 6)[Show All Hits] AC007834.40 48622 .. 48808 (187 bp)   CH003507.1 114176012 .. 114176198 (187 bp)   CH471054.1 57537088 .. 57537274 (187 bp)   CM000263.1 109913259 .. 109913445 (187 bp)   DS486258.1 864788 .. 864974 (187 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC040979.2 22981 .. 23167 (187 bp)     ESTs (5 of 56)[Show All Hits] R62152.1 162 .. 349 (188 bp)   AA044615.1 109 .. 295 (187 bp)   AA411113.1 69 .. 255 (187 bp)   AA411114.1 155 .. 341 (187 bp)   AA480088.1 68 .. 254 (187 bp)     Whole Genome Shotgun sequences (3) AADC01109760.1 16946 .. 17132 (187 bp)   AADB02015520.1 44493 .. 44679 (187 bp)   ABBA01005081.1 2812 .. 2998 (187 bp)        Macaca mulatta Name: RH78111 Polymorphism info:   Cross References UniGene Mmu.4542 Transcribed locus Mapping Information RH78111 Sequence Map: Chr 11|NW_001097731.1 Map Viewer   Position: 55960-56146 (bp)    Pan troglodytes Name: RH78111 Polymorphism info:   Cross References Gene GeneID: 467126   Symbol: GLTP   Description: glycolipid transfer protein   Position:   Mapping Information RH78111 Sequence Map: Chr 12 Map Viewer   Position: 111120752-111120938 (bp) Electronic PCR results Genomic (1) CM000326.1 111120752 .. 111120938 (187 bp)     Whole Genome Shotgun sequences (2) AADA01233834.1 10402 .. 10588 (187 bp)   AACZ02137768.1 22569 .. 22755 (187 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement