Join Evaluation Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <100 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Curator Links

Add/Update certificate

Alignment for AL845523.6 and AL844581.7

AL845523.6 Mouse DNA sequence from clone RP23-290B1 on chromosome 2 Contains the 5' end of the Chn1 gene for chimerin (chimaerin) 1, a S100 calcium binding protein A11 (calizzarin) (S100a11) pseudogene, the 3' end of the Atf2 gene for activating transcription factor 2 and a CpG island, complete sequence [htgs_phase3]

Length: 51,413 bp

AL844581.7 Mouse DNA sequence from clone RP23-146O7 on chromosome 2 Contains the 5' end of the Atf2 gene for activating transcription factor 2, the Atp5g3 gene for ATP synthase H+ transporting mitochondrial F0 complex subunit c (subunit 9) isoform 3, a glyceraldehyde-3-phosphate dehydrogenase (Gapd) pseudogene and two CpG islands, complete sequence [htgs_phase3]

Length: 207,639 bp

Alignment Summary

Join evaluation: green

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 1238
Total Length: 2000
Aligned Length: 2000
Percent Identity: 100
Number of Gaps: 0
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Alignment 1 of 1

 Mismatches = 0, Gaps = 0, Length = 2000
 Percent identity = 100%
 Score = 3965 bits (2000), Expect = 0
  2 BAC and 4 Fosmid bridging clones.
  2 BAC and 4 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL845523.6 >49414   gaattcaaccctctccctctctgatgcgtgagtacacattacaagacaagataccctgtt 49473  
AL844581.7 >1       ............................................................ 60     

AL845523.6 >49474   ttcagaaggtggaaggagaaaaccaaatgtaactaactactttccaaacaaaaatctctt 49533  
AL844581.7 >61      ............................................................ 120    

AL845523.6 >49534   tcttgcattttcataagagaagtttactaagaagttatgaatgtaggttttcaacctatt 49593  
AL844581.7 >121     ............................................................ 180    

AL845523.6 >49594   caacaacagatacattaacacttctgtatgcttaaaattatataaaacaatcattaatca 49653  
AL844581.7 >181     ............................................................ 240    

AL845523.6 >49654   ctggtttgcatataatatctacataataattaaaagttaggattatccaattagtaataa 49713  
AL844581.7 >241     ............................................................ 300    

AL845523.6 >49714   gattttaaaattgtagattattgtcaattagatacaatgtaagagttaatttttttctaa 49773  
AL844581.7 >301     ............................................................ 360    

AL845523.6 >49774   ttttaacaaaatcatcacatatttccttttaagccatcacaatccagtgcagctttcttg 49833  
AL844581.7 >361     ............................................................ 420    

AL845523.6 >49834   cataatgttgaactcagtagcatctacaggaaattaagctaagtcagatgggaaccatag 49893  
AL844581.7 >421     ............................................................ 480    

AL845523.6 >49894   tggactaatccctacagcaatcactgatatataaatcccaagcatatttctgtatggttc 49953  
AL844581.7 >481     ............................................................ 540    

AL845523.6 >49954   caatttattccacagtgtgtttcactgtcctgtcaaaatgactagatatcaaataacaga 50013  
AL844581.7 >541     ............................................................ 600    

AL845523.6 >50014   gacttatatactcaaaacagacaaaaataagtattctaaatagatatggcaattgagaat 50073  
AL844581.7 >601     ............................................................ 660    

AL845523.6 >50074   agctatgtctacagaattttttaaattaaaaaatattgctcattttgatgaaactgctta 50133  
AL844581.7 >661     ............................................................ 720    

AL845523.6 >50134   caatagactacaagtaaagatggtggccattaagttttattgtaagtacctgaggagctg 50193  
AL844581.7 >721     ............................................................ 780    

AL845523.6 >50194   tttgcatctaacacaaaatgtttccttcttttgaattactgacattggcaaattaaaatg 50253  
AL844581.7 >781     ............................................................ 840    

AL845523.6 >50254   aagtggttacatatggttgaaacaatcttcacatttacaaatatcctgaaatatcactaa 50313  
AL844581.7 >841     ............................................................ 900    

AL845523.6 >50314   atcataaaaaagaaaacaaggccgtgggttatgtattatgaatgtagcctaatgcatccc 50373  
AL844581.7 >901     ............................................................ 960    

AL845523.6 >50374   cagctcttttatttgttatgaatttgtgtgtgaccgacaaacttggccatttactcagga 50433  
AL844581.7 >961     ............................................................ 1020   

AL845523.6 >50434   gtaacagctggttcccaaactgtgcatcttgtcaagaaggacatcagagaatgaaaaagc 50493  
AL844581.7 >1021    ............................................................ 1080   

AL845523.6 >50494   acaactaacctctaccaagctcacagaagaacctcattttaggagaggaacacatttaca 50553  
AL844581.7 >1081    ............................................................ 1140   

AL845523.6 >50554   aaggaatttataagcaaatcatttcaatacagttctgctttagcatttttatggctgtga 50613  
AL844581.7 >1141    ............................................................ 1200   

AL845523.6 >50614   caataccacataaaagctcaaaaccacacaaatacagtccaatgctgacattatctaaaa 50673  
AL844581.7 >1201    ............................................................ 1260   

AL845523.6 >50674   aggatatgatactagaaatggaaagtatatggttggatgaagatattgattaaaaagttc 50733  
AL844581.7 >1261    ............................................................ 1320   

AL845523.6 >50734   tcctcagtactaaatggggccaggaagggaagagctggctctggtaatgcaagacaacat 50793  
AL844581.7 >1321    ............................................................ 1380   

AL845523.6 >50794   ggtaccctgtgagatgaatgaccactgacagtaaacagtgcacttaaaatacgtttagct 50853  
AL844581.7 >1381    ............................................................ 1440   

AL845523.6 >50854   accaacctgtgagccatactaatgcctagaaaaaaaaaaaaagctagaaataggaaaact 50913  
AL844581.7 >1441    ............................................................ 1500   

AL845523.6 >50914   tttcttcctatcccagactataataatcttgcataaattctgatatttaatcttatgtac 50973  
AL844581.7 >1501    ............................................................ 1560   

AL845523.6 >50974   tagaactgcagcttgcacatttttctttttactggtagctcagctcactctggcagtctg 51033  
AL844581.7 >1561    ............................................................ 1620   

AL845523.6 >51034   tcactgatgtagcctacagctgtaggtaatggaacattactcactatgatagccagactt 51093  
AL844581.7 >1621    ............................................................ 1680   

AL845523.6 >51094   cttctgcatggcagttacagggcaatctttatgagccagaagaagctgtttcagctgggc 51153  
AL844581.7 >1681    ............................................................ 1740   

AL845523.6 >51154   cacttcatttctcagcagggtgacttcgctctggagaagaaacaactcacatgctttagc 51213  
AL844581.7 >1741    ............................................................ 1800   

AL845523.6 >51214   agcattagatagacacatattttactatttaaagaaagcaaggcttacaggatgaaaact 51273  
AL844581.7 >1801    ............................................................ 1860   

AL845523.6 >51274   ggatctctttggcagaacaataagggacatatgctgtttaaataaatttaatcagtatac 51333  
AL844581.7 >1861    ............................................................ 1920   

AL845523.6 >51334   actggtttgcttaagcatctatgtaagtcttttagtttaaaaactaaaatcatatgaata 51393  
AL844581.7 >1921    ............................................................ 1980   

AL845523.6 >51394   ccataactgggtagccttgc 51413  
AL844581.7 >1981    .................... 2000

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time
A	51413	2001	+	+	chenhc	Taxid 10090 chrom 2 Reference assembly	2008-11-20 16:50:07.536

Events

Id	Type	Date	Whodid	Comment
2373	ImportOldDb	09/02/2005 10:54:00	f_old_db
2374	ReSetShortOvlp	09/04/2008 10:31:48	dbo
166204	CreateSwitchPt	11/20/2008 16:50:07	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-185L6				AL844581.7	100%	pos 115495 (F+)
C3H-217O1				AL844581.7	100%	pos 107465 (F-)
C3H-239I4				AL844581.7	99.04%	pos 24003 (F-)
C3H-43D6	AL845523.6	99.06%	pos 44930 (R+)
C3H-51O9				AL844581.7	100%	pos 190534 (F+)
CH29-144N5				AL844581.7	99.14%	pos 120755 (F+)
CH29-15C8	AL844581.7	99.75%	pos 179134 (R-)
CH29-17B6				AL844581.7	99.07%	pos 116506 (F+)
CH29-36D1	AL845523.6	100%	pos 6396 (R-)
CH29-496L13				AL845523.6	99.23%	pos 36010 (F-)
CH29-508F8				AL844581.7	99.51%	pos 95319 (F-)
CH29-510C9				AL844581.7	99.31%	pos 61018 (F-)
CH29-511E4				AL845523.6	100%	pos 35705 (F-)
CH29-517E17	AL844581.7	99.32%	pos 14176 (R+)
CH29-558K5				AL844581.7	99.15%	pos 151922 (F-)
CH29-558M5	AL845523.6	99.03%	pos 38628 (R+)	AL844581.7	99.05%	pos 151976 (F-)
CH29-589J19	AL844581.7	100%	pos 39577 (R-)
CH29-608K5				AL844581.7	99.44%	pos 154477 (F-)
CH29-613K19				AL845523.6	99.75%	pos 35998 (F-)
CH29-72H16				AL844581.7	99.86%	pos 50534 (F+)
CH29-92F4				AL845523.6	99.25%	pos 44500 (F-)
RP23-146J19	AL844581.7	99.03%	pos 187588 (R-)
RP23-345O11				AL844581.7	99.06%	pos 61107 (F+)
RP23-92L8				AL845523.6	99.09%	pos 38620 (F+)
RP24-145J21	AL844581.7	99.17%	pos 129222 (R-)
RP24-168H18	AL844581.7	99.66%	pos 25196 (R-)
RP24-186F20				AL844581.7	99.77%	pos 54615 (F+)
RP24-298C19	AL844581.7	99.58%	pos 58431 (R+)
RP24-326D18	AL844581.7	99.6%	pos 16372 (R+)
RP24-332H1				AL844581.7	99.33%	pos 142953 (F-)
RP24-369A22	AL845523.6	99.01%	pos 16499 (R+)	AL844581.7	99.18%	pos 151407 (F-)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-1164F22	AL845523.6	99.39%	pos 37089 (R+)	AL844581.7	100%	pos 27046 (F-)
WI1-1227B3	AL844581.7	100%	pos 71471 (R-)
WI1-1248A16				AL844581.7	99.82%	pos 171507 (F+)
WI1-125F15	AL844581.7	99.74%	pos 4077 (R-)	AL845523.6	100%	pos 18478 (F+)
WI1-1266O14	AL844581.7	100%	pos 171091 (R+)	AL844581.7	100%	pos 207394 (F-)
WI1-1506I14	AL844581.7	100%	pos 149413 (R+)	AL844581.7	99.71%	pos 191404 (F-)
WI1-1662P21				AL844581.7	100%	pos 190241 (F+)
WI1-1775O11	AL845523.6	100%	pos 34056 (R+)	AL844581.7	100%	pos 27119 (F-)
WI1-1920K11	AL844581.7	100%	pos 154552 (R+)	AL844581.7	99.73%	pos 197574 (F-)
WI1-2090D12	AL844581.7	99.39%	pos 79188 (R-)	AL844581.7	100%	pos 34973 (F+)
WI1-2105A1	AL844581.7	99.82%	pos 187812 (R-)	AL844581.7	100%	pos 147819 (F+)
WI1-2135N23				AL845523.6	100%	pos 46684 (F+)
WI1-2147O1	AL844581.7	100%	pos 97848 (R+)	AL844581.7	100%	pos 133509 (F-)
WI1-2221I11	AL845523.6	100%	pos 148 (R+)	AL845523.6	100%	pos 40790 (F-)
WI1-2388M23	AL844581.7	99.78%	pos 204258 (R-)	AL844581.7	100%	pos 164210 (F+)
WI1-2599F20	AL844581.7	99.55%	pos 135780 (R-)	AL844581.7	99.8%	pos 96592 (F+)
WI1-2638I12	AL844581.7	99.53%	pos 59326 (R+)	AL844581.7	99.36%	pos 96814 (F-)
WI1-2658P23				AL844581.7	99.54%	pos 196618 (F+)
WI1-2691E21	AL844581.7	99.77%	pos 147170 (R+)	AL844581.7	99.81%	pos 185367 (F-)
WI1-2844L15	AL844581.7	100%	pos 71415 (R+)	AL844581.7	99.84%	pos 111188 (F-)
WI1-2854P13	AL844581.7	99.84%	pos 184143 (R-)	AL844581.7	100%	pos 146311 (F+)
WI1-2885P1	AL844581.7	100%	pos 163088 (R+)
WI1-397N10	AL844581.7	99.33%	pos 9450 (R+)	AL844581.7	100%	pos 46738 (F-)
WI1-532A20	AL845523.6	100%	pos 17899 (R+)	AL844581.7	100%	pos 4634 (F-)
WI1-795M23	AL844581.7	100%	pos 178947 (R+)
WI1-894D6				AL844581.7	99.84%	pos 175676 (F+)
WI1-908N16				AL845523.6	99.79%	pos 26203 (F-)
WI1-942O7	AL844581.7	99.02%	pos 48417 (R+)

NCBI

Join Evaluation Legend

Curator Links

Alignment for AL845523.6 and AL844581.7

Alignment Summary

Alignment 1 of 1