refSNP ID: rs12720390 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 121/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/G Ancestral Allele: G Clinical Association: unknown HGVS Names NM_000797.2:c.285+343G>A NT_035113.6:g.577932G>A Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss20399290 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs12720390 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss20399290 RMOYZIS|DRD4-142426 fwd/T A/G gtcccctccgtagctggatttcacctccag gcagccagctggacagacaggcagatgcag 02/24/04 03/04/04 121 Genomic 100 %   Fasta sequence   (Legend) >gnl|dbSNP|rs12720390|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/G'|mol=Genomic|build=121 AGGCGACTTT GTCAAGCCCA GTCCCCTCCG TAGCTGGATT TCACCTCCAG R GCAGCCAGCT GGACAGACAG GCAGATGCAG GCTCAGCCCC CTGGCTGCCG   GeneView GeneView via analysis of contig annotation: DRD4 dopamine receptor D4 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_035113->NM_000797 sv function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_035113->NM_000797->NP_000788 577932 forward intron GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs12720390 maps exactly once on NCBI human chromosome 11 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 11 NW_001838016.1 278994 453140 plus G alt_assembly_8 HuRef HuRef view 50 11 NT_035113.6 577932 627932 plus G ref_assembly reference reference view 50 11 NW_924962.1 282805 703049 plus G alt_assembly_1 Celera Celera view 50   NCBI Resource Links Submitter-Referenced GenBank DRD4-142426 dbSNP Blast Analysis GenBank HTGS Finished: AP006284.2   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .