PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:53778 Links WI-17942 Homo sapiens chromosome 16, locus LOC100129781 Pan troglodytes chromosome 16, locus LOC740499 Found by e-PCR in sequences from Homo sapiens, Mus musculus and Pan troglodytes. Primer Information Forward primer: GGGAGAGAACAGCAACTGCT Reverse primer: CTACACACCCCCCTCAACC PCR product size: 131 (bp), Homo sapiens GenBank Accession: G24472 R94078    Homo sapiens Name: WI-17942 Also known as: EST341617 Polymorphism info:   Cross References Gene GeneID: 100129781   Symbol: LOC100129781   Description: hypothetical protein LOC100129781   Position: 16p13.12 UniGene Hs.640598 Transcribed locus Mapping Information WI-17942 Sequence Map: Chr 16 Map Viewer   Position: 14307168-14307299 (bp)   WI-17942 Sequence Map: Chr 16|HuRef Map Viewer   Position: 14316721-14316851 (bp)   WI-17942 Sequence Map: Chr 16|Celera Map Viewer   Position: 14575782-14575912 (bp)   WI-17942 NCBI RH Map: Chr 16 Map Viewer   Position: 139.9 (cR)   Lod score: 1.51   WI-17942 Whitehead-RH Map: Chr 16 Map Viewer   Position: 45.7 (cR3000)   Lod score: P0.58   WI-17942 GeneMap99-GB4 Map: Chr 16 Map Viewer   Position: 115.11 (cR3000)   Lod score: 3.00   Reference Interval: D16S414-D16S3114 Electronic PCR results Genomic (5 of 9)[Show All Hits] G24472.1 17 .. 147 (131 bp)   AC040173.5 121203 .. 121334 (132 bp)   AC012626.10 33244 .. 33374 (131 bp)   CH003463.1 14295895 .. 14296025 (131 bp)   CH003511.1 11085806 .. 11085936 (131 bp)     ESTs (2) R94078.1 17 .. 147 (131 bp)   CR739801.1 564 .. 694 (131 bp)     Whole Genome Shotgun sequences (4) AADD01147380.1 2986 .. 3116 (131 bp)   AADC01124560.1 42621 .. 42751 (131 bp)   AADB02017164.1 48028 .. 48158 (131 bp)   ABBA01006884.1 2827 .. 2957 (131 bp)        Mus musculus   Polymorphism info:   Electronic PCR results Working Draft phase 1 (from GenBank HTGS division) (1) AC020816.2 216056 .. 216186 (131 bp)        Pan troglodytes Name: WI-17942 Polymorphism info:   Cross References Gene GeneID: 740499   Symbol: LOC740499   Description: hypothetical protein LOC740499   Position:   Mapping Information WI-17942 Sequence Map: Chr 16 Map Viewer   Position: 14733811-14733942 (bp) Electronic PCR results Genomic (2) CM000330.1 14733811 .. 14733942 (132 bp)   AC192135.4 137002 .. 137133 (132 bp)     Whole Genome Shotgun sequences (2) AADA01286383.1 1686 .. 1817 (132 bp)   AACZ02160503.1 2097 .. 2228 (132 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement